HUGE

Gene/Protein Characteristic Table for KIAA1284

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00797
Accession No. :	AB033110
Description :	PDZ domain-containing protein 6.
HUGO Gene Name :	inturned planar cell polarity effector homolog (Drosophila) (INTU)
Clone Name :	hh09454s1 [Vector Info]
Flexi ORF Clone :	pF1KSDA1284
Source :	Human adult brain
Note :	We replaced hh09454, former representative clones for KIAA1284 with hh09454s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 3238 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 339 bp

Genome contig ID gi89161207f_128673570
PolyA signal sequence
(AATATA,-29)
+----*----+----*----+----*----+----
CAGATTAATATAGGAAATGTTTATTCTTGAAAAAT
Flanking genome sequence
(183812 - 183861)
----+----*----+----*----+----*----+----*----+----*
ACTCAATTTGTTGTTGTTTATTTTTCTCAAAATTCATACTGATATCTGAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 4 f 128773570 128857380 16 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 953 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9ULD6	100.0	PDZ domain-cont...	Homo sapiens
XP_001156541	99.0	PDZ domain cont...	Pan troglodytes
XP_001104977	97.9	similar to PDZ ...	Macaca mulatta
XP_848650	88.7	similar to PDZ ...	Canis lupus fam...
XP_001501819	88.0	inturned planar...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMSmart IPR001478 194 276 SM00228 PDZ/DHR/GLGF

ProfileScan IPR001478 196 274 PS50106 PDZ/DHR/GLGF

Search method	interpro_ID	From	To	Entry	Definition
HMMSmart	IPR001478	194	276	SM00228	PDZ/DHR/GLGF
ProfileScan	IPR001478	196	274	PS50106	PDZ/DHR/GLGF

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CAGATAGCTTGACCACTTCGC

Primer_r
: AACCATTGTCAGATCCTCCAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 4

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CAGATAGCTTGACCACTTCGC
Primer_r	: AACCATTGTCAGATCCTCCAC
PCR product length	: 156 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	339 bp
Genome contig ID	gi89161207f_128673570
PolyA signal sequence (AATATA,-29)	+--------+--------+----*----+---- CAGATTAATATAGGAAATGTTTATTCTTGAAAAAT
Flanking genome sequence (183812 - 183861)	----+--------+--------+--------+--------+----* ACTCAATTTGTTGTTGTTTATTTTTCTCAAAATTCATACTGATATCTGAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	4	f	128773570	128857380	16	99.8	Perfect prediction

Gene/Protein Characteristic Table for KIAA1284

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information