| HUGE |
Gene/Protein Characteristic Table for KIAA1281 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00796 |
|---|---|
| Accession No. : | AB033107 |
| Description : | Zinc finger protein 608. |
| HUGO Gene Name : | zinc finger protein 608 (ZNF608) |
| Clone Name : | hh04108s1 [Vector Info] |
| Flexi ORF Clone : | pF1KSDA1281
![]() |
| Source : | Human adult brain |
| Note : | We replaced hh04108, former representative clones for KIAA1281 with hh04108s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 5646 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 983 bp Genome contig ID gi51511721r_123900526 PolyA signal sequence
(ATTAAA,-26) +----*----+----*----+----*----+----
GCAATCAGAATTAAAAAGTTTTTTTTTTTTTAAATFlanking genome sequence
(99983 - 99934) ----+----*----+----*----+----*----+----*----+----*
AATGGCTTCTTGTCTGTCTCATGTTATTTTCTACCTGGCTGATAGTCATT
Chr f/r start end exon identity class ContigView(URL based/DAS) 5 r 124000509 124108704 9 99.4 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 1534 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|

Experimental conditions
| : GCACGTATGGCAGTAGCAAGC | |
| : ACTCCTCTGTTACCTAATTCC | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 5 |
| : GeneBridge 4 | |
| : GCACGTATGGCAGTAGCAAGC | |
| : ACTCCTCTGTTACCTAATTCC | |
| : 156 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |