HUGE

Gene/Protein Characteristic Table for KIAA0295

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07501
Accession No. :	AB002293
Description :	Zinc finger protein 609.
HUGO Gene Name :	zinc finger protein 609 (ZNF609)
Clone Name :	hf00226 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 7326 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Features of the protein sequence	Description

Length: 981 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW77686	99.9	zinc finger pro...	Homo sapiens
XP_510473	99.9	zinc finger pro...	Pan troglodytes
EAW77688	99.9	zinc finger pro...	Homo sapiens
O15014	99.9	Zinc finger pro...	Homo sapiens
XP_001107905	99.0	similar to zinc...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB033107	3.3e-11	43.1	KIAA1281

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ProfileScan IPR007087 65 95 PS50157 Zinc finger

ScanRegExp IPR007087 67 90 PS00028 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	IPR007087	65	95	PS50157	Zinc finger
ScanRegExp	IPR007087	67	90	PS00028	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: GAGTTTTAGGGGTAGTTTTCC

Primer_r
: GTGAAACTATGCAGCTGGGAG

PCR conditions
: 95 °C15 sec62 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 15

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GAGTTTTAGGGGTAGTTTTCC
Primer_r	: GTGAAACTATGCAGCTGGGAG
PCR product length	: 111 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Gene/Protein Characteristic Table for KIAA0295

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information