HUGE

Gene/Protein Characteristic Table for KIAA1258

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00784
Accession No. :	AB033084
Description :	Guanine deaminase.
HUGO Gene Name :
Clone Name :	hh15704 [Vector Info]
Flexi ORF Clone :	pF1KSDA1258
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5321 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3880 bp

Genome contig ID gi89161216f_73854220
PolyA signal sequence
(AATAAA,-26)
+----*----+----*----+----*----+----
TCAGACAAAAATAAATGAGACTTTGTGTTTACGTT
Flanking genome sequence
(202741 - 202790)
----+----*----+----*----+----*----+----*----+----*
ATTTTTTGTTGTGAGTTCTCTCTGTTTGGTTTTGTTGTGAATTCTATCAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 9 f 73954220 74056959 14 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 479 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_528320	6.5e-199	99.2	similar to guan...	Pan troglodytes
Q9Y2T3	3.4e-190	100.0	Guanine deamina...	Homo sapiens
EAW62528	3.5e-190	100.0	guanine deamina...	Homo sapiens
2UZ9	3.6e-190	100.0	HUMAN GUANINE D...	Homo sapiens
AAG40469	3e-189	99.3	guanine aminohy...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR006680 98 426 PF01979 Amidohydrolase 1

HMMTigr IPR014311 51 469 TIGR02967 Guanine deaminase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006680	98	426	PF01979	Amidohydrolase 1
HMMTigr	IPR014311	51	469	TIGR02967	Guanine deaminase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ATCCTAACATTGGTCTCCGTG

Primer_r
: TCATTTGAACCCTGTGGACTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 9

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3880 bp
Genome contig ID	gi89161216f_73854220
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- TCAGACAAAAATAAATGAGACTTTGTGTTTACGTT
Flanking genome sequence (202741 - 202790)	----+--------+--------+--------+--------+----* ATTTTTTGTTGTGAGTTCTCTCTGTTTGGTTTTGTTGTGAATTCTATCAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	9	f	73954220	74056959	14	99.3	Perfect prediction

Primer_f	: ATCCTAACATTGGTCTCCGTG
Primer_r	: TCATTTGAACCCTGTGGACTG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1258

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information