HUGE

Gene/Protein Characteristic Table for KIAA1255

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04104
Accession No. :	AB033081
Description :	Ankyrin repeat and FYVE domain-containing protein 1.
HUGO Gene Name :	ankyrin repeat and FYVE domain containing 1 (ANKFY1)
Clone Name :	hh14633s1 [Vector Info]
Flexi ORF Clone :	pF1KA1255
Source :	Human adult brain
Note :	We replaced hh14633, former representative clones for KIAA1255 with hh14633s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 6457 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2704 bp

Genome contig ID gi51511734r_3915117
PolyA signal sequence
(CATAAA,-19)
+----*----+----*----+----*----+----
TAACACCGAAATTTCCCATAAACTTAAGTGCCTAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACTTAGGACTTTTGAACTTTCAGTCATCTTTTTCGTGGTGTCTCACTGAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 17 r 4015117 4113891 25 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 1232 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG72458	100.0	ankyrin repeat ...	synthetic construct
XP_001160123	99.3	ankyrin repeat ...	Pan troglodytes
Q9P2R3	99.9	Ankyrin repeat ...	Homo sapiens
AAI48356	99.8	Ankyrin repeat ...	synthetic construct
XP_001160079	99.3	ankyrin repeat ...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB033049	1.5e-10	27.2	KIAA1223
D86982	7e-06	31.1	KIAA0229
AB023174	1.5e-05	33.9	KIAA0957
AB014597	4.1e-05	24.1	KIAA0697
AB023210	6.7e-05	29.0	KIAA0993

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR002110 554 566 PR01415 Ankyrin

IPR002110 618 630 PR01415 Ankyrin

HMMPfam IPR013069 121 225 PF00651 BTB/POZ

IPR002110 318 350 PF00023 Ankyrin

IPR002110 351 383 PF00023 Ankyrin

IPR002110 385 428 PF00023 Ankyrin

IPR002110 429 462 PF00023 Ankyrin

IPR002110 463 518 PF00023 Ankyrin

IPR002110 520 552 PF00023 Ankyrin

IPR002110 553 585 PF00023 Ankyrin

IPR002110 605 637 PF00023 Ankyrin

IPR002110 651 683 PF00023 Ankyrin

IPR002110 684 716 PF00023 Ankyrin

IPR002110 717 749 PF00023 Ankyrin

IPR002110 750 776 PF00023 Ankyrin

IPR002110 787 819 PF00023 Ankyrin

IPR002110 832 864 PF00023 Ankyrin

IPR002110 865 898 PF00023 Ankyrin

IPR002110 933 965 PF00023 Ankyrin

IPR002110 968 1000 PF00023 Ankyrin

IPR002110 1001 1033 PF00023 Ankyrin

IPR002110 1034 1067 PF00023 Ankyrin

IPR002110 1068 1105 PF00023 Ankyrin

IPR002110 1106 1138 PF00023 Ankyrin

IPR000306 1165 1228 PF01363 Zinc finger

HMMSmart IPR000210 131 225 SM00225 BTB/POZ-like

IPR002110 318 347 SM00248 Ankyrin

IPR002110 351 380 SM00248 Ankyrin

IPR002110 385 425 SM00248 Ankyrin

IPR002110 429 459 SM00248 Ankyrin

IPR002110 463 515 SM00248 Ankyrin

IPR002110 553 582 SM00248 Ankyrin

IPR002110 605 635 SM00248 Ankyrin

IPR002110 651 680 SM00248 Ankyrin

IPR002110 684 713 SM00248 Ankyrin

IPR002110 717 746 SM00248 Ankyrin

IPR002110 750 779 SM00248 Ankyrin

IPR002110 787 816 SM00248 Ankyrin

IPR002110 832 861 SM00248 Ankyrin

IPR002110 865 893 SM00248 Ankyrin

IPR002110 899 928 SM00248 Ankyrin

IPR002110 933 962 SM00248 Ankyrin

IPR002110 968 997 SM00248 Ankyrin

IPR002110 1001 1030 SM00248 Ankyrin

IPR002110 1034 1064 SM00248 Ankyrin

IPR002110 1068 1102 SM00248 Ankyrin

IPR002110 1106 1137 SM00248 Ankyrin

IPR000306 1162 1228 SM00064 Zinc finger

ProfileScan IPR000210 131 193 PS50097 BTB/POZ-like

IPR002110 280 1161 PS50297 Ankyrin

IPR002110 385 428 PS50088 Ankyrin

IPR002110 429 462 PS50088 Ankyrin

IPR002110 553 585 PS50088 Ankyrin

IPR002110 605 637 PS50088 Ankyrin

IPR002110 684 716 PS50088 Ankyrin

IPR002110 717 749 PS50088 Ankyrin

IPR002110 832 864 PS50088 Ankyrin

IPR002110 933 965 PS50088 Ankyrin

IPR002110 968 1000 PS50088 Ankyrin

IPR002110 1001 1033 PS50088 Ankyrin

IPR002110 1034 1055 PS50088 Ankyrin

IPR002110 1106 1138 PS50088 Ankyrin

IPR000306 1167 1227 PS50178 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002110	554	566	PR01415	Ankyrin
IPR002110	618	630	PR01415	Ankyrin
HMMPfam	IPR013069	121	225	PF00651	BTB/POZ
IPR002110	318	350	PF00023	Ankyrin
IPR002110	351	383	PF00023	Ankyrin
IPR002110	385	428	PF00023	Ankyrin
IPR002110	429	462	PF00023	Ankyrin
IPR002110	463	518	PF00023	Ankyrin
IPR002110	520	552	PF00023	Ankyrin
IPR002110	553	585	PF00023	Ankyrin
IPR002110	605	637	PF00023	Ankyrin
IPR002110	651	683	PF00023	Ankyrin
IPR002110	684	716	PF00023	Ankyrin
IPR002110	717	749	PF00023	Ankyrin
IPR002110	750	776	PF00023	Ankyrin
IPR002110	787	819	PF00023	Ankyrin
IPR002110	832	864	PF00023	Ankyrin
IPR002110	865	898	PF00023	Ankyrin
IPR002110	933	965	PF00023	Ankyrin
IPR002110	968	1000	PF00023	Ankyrin
IPR002110	1001	1033	PF00023	Ankyrin
IPR002110	1034	1067	PF00023	Ankyrin
IPR002110	1068	1105	PF00023	Ankyrin
IPR002110	1106	1138	PF00023	Ankyrin
IPR000306	1165	1228	PF01363	Zinc finger
HMMSmart	IPR000210	131	225	SM00225	BTB/POZ-like
IPR002110	318	347	SM00248	Ankyrin
IPR002110	351	380	SM00248	Ankyrin
IPR002110	385	425	SM00248	Ankyrin
IPR002110	429	459	SM00248	Ankyrin
IPR002110	463	515	SM00248	Ankyrin
IPR002110	553	582	SM00248	Ankyrin
IPR002110	605	635	SM00248	Ankyrin
IPR002110	651	680	SM00248	Ankyrin
IPR002110	684	713	SM00248	Ankyrin
IPR002110	717	746	SM00248	Ankyrin
IPR002110	750	779	SM00248	Ankyrin
IPR002110	787	816	SM00248	Ankyrin
IPR002110	832	861	SM00248	Ankyrin
IPR002110	865	893	SM00248	Ankyrin
IPR002110	899	928	SM00248	Ankyrin
IPR002110	933	962	SM00248	Ankyrin
IPR002110	968	997	SM00248	Ankyrin
IPR002110	1001	1030	SM00248	Ankyrin
IPR002110	1034	1064	SM00248	Ankyrin
IPR002110	1068	1102	SM00248	Ankyrin
IPR002110	1106	1137	SM00248	Ankyrin
IPR000306	1162	1228	SM00064	Zinc finger
ProfileScan	IPR000210	131	193	PS50097	BTB/POZ-like
IPR002110	280	1161	PS50297	Ankyrin
IPR002110	385	428	PS50088	Ankyrin
IPR002110	429	462	PS50088	Ankyrin
IPR002110	553	585	PS50088	Ankyrin
IPR002110	605	637	PS50088	Ankyrin
IPR002110	684	716	PS50088	Ankyrin
IPR002110	717	749	PS50088	Ankyrin
IPR002110	832	864	PS50088	Ankyrin
IPR002110	933	965	PS50088	Ankyrin
IPR002110	968	1000	PS50088	Ankyrin
IPR002110	1001	1033	PS50088	Ankyrin
IPR002110	1034	1055	PS50088	Ankyrin
IPR002110	1106	1138	PS50088	Ankyrin
IPR000306	1167	1227	PS50178	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AGCTGACTCCAACATGCCCTG

Primer_r
: GAAAACTTACAACAGCTAGGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 17

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AGCTGACTCCAACATGCCCTG
Primer_r	: GAAAACTTACAACAGCTAGGC
PCR product length	: 114 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2704 bp
Genome contig ID	gi51511734r_3915117
PolyA signal sequence (CATAAA,-19)	+--------+--------+----*----+---- TAACACCGAAATTTCCCATAAACTTAAGTGCCTAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACTTAGGACTTTTGAACTTTCAGTCATCTTTTTCGTGGTGTCTCACTGAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	17	r	4015117	4113891	25	99.5	Perfect prediction

Gene/Protein Characteristic Table for KIAA1255

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information