| HUGE |
Gene/Protein Characteristic Table for KIAA1245 |
|
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00778 |
|---|---|
| Accession No. : | AB033071 |
| Description : | |
| HUGO Gene Name : | |
| Clone Name : | hg04073 [Vector Info] |
| Flexi ORF Clone : | pF1KSDA1245
![]() |
| Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 6896 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 0 bp Genome contig ID gi89161185f_143213012 PolyA signal sequence
(AAGAAA,-23) +----*----+----*----+----*----+----
AAGGGGAAGGGGAAGAAAAGAAGGGGAAGAAGATCFlanking genome sequence
(862958 - 863007) ----+----*----+----*----+----*----+----*----+----*
AAAGAAGGAAAGAAGAAGGGGAAGAAAAGAAGGGGAAGAAGATCAAAACC
Chr f/r start end exon identity class ContigView(URL based/DAS) 1 f 143309862 144075968 54 96.8 Terminal No-hit ContigView(URL based/DAS) 1 r 146042726 146082596 26 98.7 Both No-hit ContigView(URL based/DAS) 1 f 146827464 147023143 27 96.6 Both No-hit
Features of the protein sequence |
Description | |
|---|---|---|
Length: 892 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|

Experimental conditions
| : TCATTGTCTTCTTCAGGTGGC | |
| : GTAACCGTCTTGATCCATAGG | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 1 |
| : GeneBridge 4 | |
| : CCATCACTTGTTCAAATAGCC | |
| : GAGAGGATGAGCCAATGAGAG | |
| : 114 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |