HUGE

Gene/Protein Characteristic Table for KIAA1693

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06105
Accession No. :	AB051480
Description :	Neuroblastoma breakpoint family member 10.
HUGO Gene Name :	neuroblastoma breakpoint family, member 1 (NBPF1)
Clone Name :	fj10588 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4239 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1531 bp

Genome contig ID gi89161185f_143906782
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TTAAAAGCTTTTGCCTCTAGATCGCGGGCGGCCGC
Flanking genome sequence
(1127476 - 1127427)
----+----*----+----*----+----*----+----*----+----*
AACTTATATTCCAAAGATCTTTTTTATTTTAATTTTTTAAATTTGTTTTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 143326610 143541655 20 96.4 Terminal No-hit

ContigView(URL based/DAS) 1 f 144004887 144081552 21 96.7 Terminal No-hit

ContigView(URL based/DAS) 1 f 147006309 147024822 15 96.5 Terminal No-hit

ContigView(URL based/DAS) 1 f 146844224 146862778 15 96.0 Terminal No-hit

ContigView(URL based/DAS) 1 r 16761513 16784621 18 99.5 Both No-hit

Features of the protein sequence	Description

Length: 901 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q3BBV0	97.9	Neuroblastoma b...	Homo sapiens
Q3BBV1	93.7	Neuroblastoma b...	Homo sapiens
CAM23768	92.7	neuroblastoma b...	Homo sapiens
AAH86308	95.0	NBPF8 protein [...	Homo sapiens
Q3BBV2	94.5	Neuroblastoma b...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB033071	3.5e-115	94.1	KIAA1245
AB007923	2.4e-05	28.7	KIAA0454

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR010630 138 201 PF06758 Protein of unknown function DUF1220

IPR010630 409 471 PF06758 Protein of unknown function DUF1220

IPR010630 495 558 PF06758 Protein of unknown function DUF1220

IPR010630 567 633 PF06758 Protein of unknown function DUF1220

IPR010630 642 708 PF06758 Protein of unknown function DUF1220

IPR010630 717 783 PF06758 Protein of unknown function DUF1220

IPR010630 812 878 PF06758 Protein of unknown function DUF1220

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR010630	138	201	PF06758	Protein of unknown function DUF1220
IPR010630	409	471	PF06758	Protein of unknown function DUF1220
IPR010630	495	558	PF06758	Protein of unknown function DUF1220
IPR010630	567	633	PF06758	Protein of unknown function DUF1220
IPR010630	642	708	PF06758	Protein of unknown function DUF1220
IPR010630	717	783	PF06758	Protein of unknown function DUF1220
IPR010630	812	878	PF06758	Protein of unknown function DUF1220

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CATGTCTCTGAGCTTCTATAC

Primer_r
: GTGTTACAGATGGATCAGCTA

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1531 bp
Genome contig ID	gi89161185f_143906782
PolyA signal sequence (None)	+--------+--------+----*----+---- TTAAAAGCTTTTGCCTCTAGATCGCGGGCGGCCGC
Flanking genome sequence (1127476 - 1127427)	----+--------+--------+--------+--------+----* AACTTATATTCCAAAGATCTTTTTTATTTTAATTTTTTAAATTTGTTTTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	143326610	143541655	20	96.4	Terminal No-hit
ContigView(URL based/DAS)	1	f	144004887	144081552	21	96.7	Terminal No-hit
ContigView(URL based/DAS)	1	f	147006309	147024822	15	96.5	Terminal No-hit
ContigView(URL based/DAS)	1	f	146844224	146862778	15	96.0	Terminal No-hit
ContigView(URL based/DAS)	1	r	16761513	16784621	18	99.5	Both No-hit

Primer_f	: CATGTCTCTGAGCTTCTATAC
Primer_r	: GTGTTACAGATGGATCAGCTA
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1693

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information