HUGE

Gene/Protein Characteristic Table for KIAA1200

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00763
Accession No. :	AB033026
Description :	pleckstrin homology domain containing, family H (with MyTH4 domain) member 1.
HUGO Gene Name :	pleckstrin homology domain containing, family H (with MyTH4 domain) member 1 (PLEKHH1)
Clone Name :	fg02656 [Vector Info]
Flexi ORF Clone :	pF1KSDA1200
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 6512 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2299 bp

Genome contig ID gi51511730f_66969785
PolyA signal sequence
(AATAAA,-28)
+----*----+----*----+----*----+----
GTTTGTCAATAAAAAGCAGCTATCTGTGAACCAGG
Flanking genome sequence
(156221 - 156270)
----+----*----+----*----+----*----+----*----+----*
TAACTGTGTGTTTTGGAAGATCTGTTTATTAACAGTAAATAAATAAGCCC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 14 f 67069785 67126004 29 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 1403 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW80940	99.9	pleckstrin homo...	Homo sapiens
Q9ULM0	100.0	Pleckstrin homo...	Homo sapiens
XP_001916221	86.5	pleckstrin homo...	Equus caballus
XP_537487	85.7	similar to plec...	Canis lupus fam...
XP_001925997	86.4	pleckstrin homo...	Sus scrofa

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB095948	1.1e-121	48.4	KIAA2028

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001849 618 711 PF00169 Pleckstrin-like

IPR001849 727 835 PF00169 Pleckstrin-like

IPR000857 913 1025 PF00784 Unconventional myosin/plant kinesin-like protein/non-motor protein conserved region MyTH4

HMMSmart IPR001849 618 713 SM00233 Pleckstrin-like

IPR001849 727 837 SM00233 Pleckstrin-like

IPR000857 871 1025 SM00139 Unconventional myosin/plant kinesin-like protein/non-motor protein conserved region MyTH4

IPR000299 1032 1269 SM00295 Band 4.1

ProfileScan IPR001849 617 711 PS50003 Pleckstrin-like

IPR001849 726 835 PS50003 Pleckstrin-like

IPR000857 871 1025 PS51016 Unconventional myosin/plant kinesin-like protein/non-motor protein conserved region MyTH4

IPR000299 1036 1372 PS50057 Band 4.1

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001849	618	711	PF00169	Pleckstrin-like
IPR001849	727	835	PF00169	Pleckstrin-like
IPR000857	913	1025	PF00784	Unconventional myosin/plant kinesin-like protein/non-motor protein conserved region MyTH4
HMMSmart	IPR001849	618	713	SM00233	Pleckstrin-like
IPR001849	727	837	SM00233	Pleckstrin-like
IPR000857	871	1025	SM00139	Unconventional myosin/plant kinesin-like protein/non-motor protein conserved region MyTH4
IPR000299	1032	1269	SM00295	Band 4.1
ProfileScan	IPR001849	617	711	PS50003	Pleckstrin-like
IPR001849	726	835	PS50003	Pleckstrin-like
IPR000857	871	1025	PS51016	Unconventional myosin/plant kinesin-like protein/non-motor protein conserved region MyTH4
IPR000299	1036	1372	PS50057	Band 4.1

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GGCAGCCTTACTATATGTCAG

Primer_r
: CATGCTTGTCAGTTTACGGGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 14

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GGCAGCCTTACTATATGTCAG
Primer_r	: CATGCTTGTCAGTTTACGGGG
PCR product length	: 190 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2299 bp
Genome contig ID	gi51511730f_66969785
PolyA signal sequence (AATAAA,-28)	+--------+--------+----*----+---- GTTTGTCAATAAAAAGCAGCTATCTGTGAACCAGG
Flanking genome sequence (156221 - 156270)	----+--------+--------+--------+--------+----* TAACTGTGTGTTTTGGAAGATCTGTTTATTAACAGTAAATAAATAAGCCC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	14	f	67069785	67126004	29	99.5	Perfect prediction

Gene/Protein Characteristic Table for KIAA1200

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information