HUGE

Gene/Protein Characteristic Table for KIAA1187

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00758
Accession No. :	AB033013
Description :	MAP7 domain containing 1.
HUGO Gene Name :
Clone Name :	fk03027 [Vector Info]
Flexi ORF Clone :	pF1KSDA1187
Source :	Human fetal brain
Note :	We replaced hg02694a, former representative clones for KIAA1187 with fk03027. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 3454 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 589 bp

Genome contig ID gi89161185f_36294153
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
ATTAAATGTCTCCAGAAATAAAGAATAATTCTGCC
Flanking genome sequence
(124884 - 124933)
----+----*----+----*----+----*----+----*----+----*
AATCCTGCCTGTTCTTGGAGCTGGTGGCGGAGGTGGGAGCAGATGGCCTC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 36394153 36419035 16 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 813 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAG09988	1.3e-165	100.0	MAP7 domain-con...	synthetic construct
XP_001110370	1.2e-160	97.1	similar to prol...	Macaca mulatta
XP_001110203	3e-157	97.2	similar to prol...	Macaca mulatta
EAX07381	2e-148	91.8	arginine/prolin...	Homo sapiens
XP_001057759	7.4e-140	84.9	similar to prol...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR008604 549 708 PF05672 E-MAP-115

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR008604	549	708	PF05672	E-MAP-115

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ACAAGAGTCTGAGCCGAACAC

Primer_r
: TGGTAGGTGATGCAGAGGAGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	589 bp
Genome contig ID	gi89161185f_36294153
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- ATTAAATGTCTCCAGAAATAAAGAATAATTCTGCC
Flanking genome sequence (124884 - 124933)	----+--------+--------+--------+--------+----* AATCCTGCCTGTTCTTGGAGCTGGTGGCGGAGGTGGGAGCAGATGGCCTC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	36394153	36419035	16	100.0	Perfect prediction

Primer_f	: ACAAGAGTCTGAGCCGAACAC
Primer_r	: TGGTAGGTGATGCAGAGGAGC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1187

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information