ROUGE |
Gene/Protein Characteristic Table for mKIAA1187 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK122462 |
---|---|
mbg00181 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5090 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 1121 bp Genome contig ID gi65493515r_125159284 PolyA signal sequence
(AATAAA,-23) +----*----+----*----+----*----+----
AACTTCTCCGGAAATAAAGGGAGAAAAATTCTGCCFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAACCTACGTGTCCTTGGATCTGGGGGAGGGGGAGGGGGAAGAGAGGTAC
KIAA Alignment based on: KIAA1187 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 1014..1520, 3058..3882, 4208..4504
Length: 542 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage ![]() | |