HUGE

Gene/Protein Characteristic Table for KIAA1167

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :
Accession No. :	AB032993
Description :	GRIP1-associated protein 1.
HUGO Gene Name :	GRIP1 associated protein 1 (GRIPAP1)
Clone Name :	hj01786 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5097 bp
Physical map
Restriction map
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
Comparison between the cloned and the revised DNA sequences.
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq. revised DNA seq.
Warning for N-terminal truncation:
YES YES

Warning for coding interruption:
YES NO

Integrity of 3' end

Length of 3'UTR 471 bp

Genome contig ID gi89161218r_48615078
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GCCAAAATACCATCTGGCCAGACGGGCCCACCCAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
TGACTGTCTCGTCTCGTTCTTTTCAACCAGGAGGAATATGCTGGGGGCGG

Features of the protein sequence	Description

Length: 834 aa
This protein sequence is predicted from the revised DNA sequence

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q4V328	0	100.0	GRIP1-associate...	Homo sapiens
BAF84847	0	99.9	unnamed protein...	Homo sapiens
XP_873320	3e-209	94.8	similar to GRIP...	Bos taurus
XP_548991	1.2e-208	94.8	similar to GRIP...	Canis lupus fam...
CAM13602	9.3e-205	93.2	GRIP1 associate...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB028975	0.00033	23.7	KIAA1052
AB007914	0.00034	25.0	KIAA0445
AB051536	0.00041	23.6	KIAA1749

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AGCGCCATCATTGAGACCTAC

Primer_r
: ATGGTCTTGTCAGTAGCTTCG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: X

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AGCGCCATCATTGAGACCTAC
Primer_r	: ATGGTCTTGTCAGTAGCTTCG
PCR product length	: 162 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.	revised DNA seq.
Warning for N-terminal truncation:	YES	YES
Warning for coding interruption:	YES	NO

Length of 3'UTR	471 bp
Genome contig ID	gi89161218r_48615078
PolyA signal sequence (None)	+--------+--------+----*----+---- GCCAAAATACCATCTGGCCAGACGGGCCCACCCAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TGACTGTCTCGTCTCGTTCTTTTCAACCAGGAGGAATATGCTGGGGGCGG

Gene/Protein Characteristic Table for KIAA1167

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information