HUGE

Gene/Protein Characteristic Table for KIAA1163

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04094
Accession No. :	AB032989
Description :	Amphoterin-induced protein 1 precursor.
HUGO Gene Name :	adhesion molecule with Ig-like domain 1 (AMIGO1)
Clone Name :	hj05329 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4568 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3252 bp

Genome contig ID gi89161185r_109748324
PolyA signal sequence
(ATTAAA,-30)
+----*----+----*----+----*----+----
TGATCATTAAACCTGGCTTGAGTCTCTGTTCTGGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACAATCTGACTGGTTTATTTTTTCAGCCTGTGGGTGGGGTTCACTGTACC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 r 109848324 109852891 1 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 437 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q86WK6	4.9e-180	100.0	Amphoterin-indu...	Homo sapiens
AAH40879	1.2e-179	99.8	Adhesion molecu...	Homo sapiens
XP_547241	1.9e-173	96.3	similar to Amph...	Canis lupus fam...
AAI51606	4.6e-173	95.9	AMIGO1 protein ...	Bos taurus
XP_001494891	1.4e-171	95.4	similar to LOC5...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058754	4e-23	37.3	KIAA1851
D86983	2.5e-12	28.2	KIAA0230
AB020725	1.5e-07	31.4	KIAA0918
AB058757	2.5e-07	26.2	KIAA1854
AB020655	3.3e-07	29.6	KIAA0848

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001611 56 69 PR00019 Leucine-rich repeat

IPR001611 128 141 PR00019 Leucine-rich repeat

HMMPfam IPR001611 31 53 PF00560 Leucine-rich repeat

IPR001611 55 77 PF00560 Leucine-rich repeat

IPR001611 103 121 PF00560 Leucine-rich repeat

IPR001611 130 152 PF00560 Leucine-rich repeat

IPR013151 227 287 PF00047 Immunoglobulin

HMMSmart IPR003591 29 52 SM00369 Leucine-rich repeat

IPR003591 53 76 SM00369 Leucine-rich repeat

IPR003591 77 100 SM00369 Leucine-rich repeat

IPR003591 101 124 SM00369 Leucine-rich repeat

IPR003591 128 151 SM00369 Leucine-rich repeat

IPR000483 165 215 SM00082 Cysteine-rich flanking region

IPR003599 219 303 SM00409 Immunoglobulin subtype

ProfileScan IPR007110 227 297 PS50835 Immunoglobulin-like

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	56	69	PR00019	Leucine-rich repeat
IPR001611	128	141	PR00019	Leucine-rich repeat
HMMPfam	IPR001611	31	53	PF00560	Leucine-rich repeat
IPR001611	55	77	PF00560	Leucine-rich repeat
IPR001611	103	121	PF00560	Leucine-rich repeat
IPR001611	130	152	PF00560	Leucine-rich repeat
IPR013151	227	287	PF00047	Immunoglobulin
HMMSmart	IPR003591	29	52	SM00369	Leucine-rich repeat
IPR003591	53	76	SM00369	Leucine-rich repeat
IPR003591	77	100	SM00369	Leucine-rich repeat
IPR003591	101	124	SM00369	Leucine-rich repeat
IPR003591	128	151	SM00369	Leucine-rich repeat
IPR000483	165	215	SM00082	Cysteine-rich flanking region
IPR003599	219	303	SM00409	Immunoglobulin subtype
ProfileScan	IPR007110	227	297	PS50835	Immunoglobulin-like

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 316 TAYTTLVGCILSVVLVLIYLYLT 338 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	316	TAYTTLVGCILSVVLVLIYLYLT	338	PRIMARY	23

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TGAGTTTGAGACACCTGGTAG

Primer_r
: TTCTAGTGCGCTTACATATGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3252 bp
Genome contig ID	gi89161185r_109748324
PolyA signal sequence (ATTAAA,-30)	+--------+--------+----*----+---- TGATCATTAAACCTGGCTTGAGTCTCTGTTCTGGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACAATCTGACTGGTTTATTTTTTCAGCCTGTGGGTGGGGTTCACTGTACC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	r	109848324	109852891	1	99.0	Perfect prediction

Primer_f	: TGAGTTTGAGACACCTGGTAG
Primer_r	: TTCTAGTGCGCTTACATATGC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1163

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information