| HUGE |
Gene/Protein Characteristic Table for KIAA1140 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00184 |
|---|---|
| Accession No. : | AB032966 |
| Description : | Tetratricopeptide repeat protein 7A. |
| HUGO Gene Name : | tetratricopeptide repeat domain 7A (TTC7A) |
| Clone Name : | hk01004s1 [Vector Info] |
| Flexi ORF Clone : | pF1KA1140
![]() |
| Source : | Human adult brain |
| Note : | We replaced hk01004, former representative clones for KIAA1140 with hk01004s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4748 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 2223 bp Genome contig ID gi89161199f_46931064 PolyA signal sequence
(ATTAAA,-34) +----*----+----*----+----*----+----
CATTAAAACAACTCTAAAGAACGCTGCTCATTTACFlanking genome sequence
(225718 - 225767) ----+----*----+----*----+----*----+----*----+----*
ACAGAAGCTCTGTTTCTTCCTGTACCCCAGGGGGTCACCATAGCACCCCC
Chr f/r start end exon identity class ContigView(URL based/DAS) 2 f 47031064 47156780 21 99.5 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 752 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|

Experimental conditions
| : AGAAGTCCATACCAGTACACC | |
| : AATGAGCAGCGTTCTTTAGAG | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 2 |
| : GeneBridge 4 | |
| : AGAAGTCCATACCAGTACACC | |
| : AATGAGCAGCGTTCTTTAGAG | |
| : 101 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |