HUGE

Gene/Protein Characteristic Table for KIAA1115

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK01151
Accession No. :	AB029038
Description :	SAPS domain family member 1.
HUGO Gene Name :
Clone Name :	hk05464 [Vector Info]
Flexi ORF Clone :	pF1KA1115
Source :	Human adult brain
Note :	We replaced hk02303, former representative clones for KIAA1115 with hk05464. (2004/1/10)

Features of the cloned DNA sequence	Description

Length: 3961 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 748 bp

Genome contig ID gi42406306r_60332960
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
ATATTGCAAATATAAATAAAGGAAGGCAGTTTACG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATTCTGCTGGTCAGACCTTACGTTCTGGGATGCGGGGTGGGGAGCCTGTA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 19 r 60432960 60462175 24 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 895 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9UPN7	100.0	Serine/threonin...	Homo sapiens
EAW72353	100.0	SAPS domain fam...	Homo sapiens
AAH68014	100.0	SAPS1 protein [...	Homo sapiens
AAH02799	100.0	SAPS1 protein [...	Homo sapiens
XP_001489717	89.0	similar to SAPS...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046778	2.7e-47	46.6	KIAA1558
AB014585	2.9e-25	42.2	KIAA0685

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR007587 142 533 PF04499 SIT4 phosphatase-associated protein

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007587	142	533	PF04499	SIT4 phosphatase-associated protein

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

: 19

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AAATCTTCCGTCCTCCCGTGG
Primer_r	: CTCTTCTCAGTGCAAATGGGG
PCR product length	: 167 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	748 bp
Genome contig ID	gi42406306r_60332960
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- ATATTGCAAATATAAATAAAGGAAGGCAGTTTACG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTCTGCTGGTCAGACCTTACGTTCTGGGATGCGGGGTGGGGAGCCTGTA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	19	r	60432960	60462175	24	99.9	Perfect prediction

Gene/Protein Characteristic Table for KIAA1115

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information