HUGE

Gene/Protein Characteristic Table for KIAA0685

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00604
Accession No. :	AB014585
Description :	SAPS domain family member 2.
HUGO Gene Name :
Clone Name :	hk02959 [Vector Info]
Flexi ORF Clone :	pF1KSDA0685
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 3981 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Features of the protein sequence	Description

Length: 939 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAO03456	100.0	SAPS domain fam...	Homo sapiens
AAH06568	99.8	SAPS domain fam...	Homo sapiens
AAH32664	99.7	SAPS domain fam...	Homo sapiens
AAH52995	96.7	SAPS2 protein [...	Homo sapiens
Q8R3Q2	81.9	Serine/threonin...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046778	1.1e-60	46.4	KIAA1558
AB029038	7.8e-40	42.1	KIAA1115

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR007587 140 544 PF04499 SIT4 phosphatase-associated protein

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007587	140	544	PF04499	SIT4 phosphatase-associated protein

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: AGTTGAAACCAGTTGGACGGC

Primer_r
: CGACCTTATTGCTGTGCTCTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 22

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AGTTGAAACCAGTTGGACGGC
Primer_r	: CGACCTTATTGCTGTGCTCTG
PCR product length	: 131 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Gene/Protein Characteristic Table for KIAA0685

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information