HUGE

Gene/Protein Characteristic Table for KIAA1072

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00730
Accession No. :	AB028995
Description :	Protein phosphatase 1E.
HUGO Gene Name :	protein phosphatase 1E (PP2C domain containing) (PPM1E)
Clone Name :	hj06360 [Vector Info]
Flexi ORF Clone :	pF1KSDA1072
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5035 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2634 bp

Genome contig ID gi51511734f_54088231
PolyA signal sequence
(TATAAA,-22)
+----*----+----*----+----*----+----
TCTATATAATATCTATAAACTGTTAATGCTGAGGT
Flanking genome sequence
(327579 - 327628)
----+----*----+----*----+----*----+----*----+----*
ATAGTCTGTGAATTATGTGTTTTGTATTTTTATTCATTGTGTAATTTAGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 17 f 54188231 54415808 7 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 759 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAM76058	100.0	partner of PIX ...	Homo sapiens
NP_055721	99.7	protein phospha...	Homo sapiens
XP_853253	91.0	similar to prot...	Canis lupus fam...
Q8WY54	98.7	Protein phospha...	Homo sapiens
Q80TL0	89.3	Protein phospha...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D13640	1.7e-28	47.1	KIAA0015

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR014045 234 485 PF00481 Protein phosphatase 2C

HMMSmart IPR001932 223 490 SM00332 Protein phosphatase 2C-related

ScanRegExp IPR000222 272 280 PS01032 Protein phosphatase 2C

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR014045	234	485	PF00481	Protein phosphatase 2C
HMMSmart	IPR001932	223	490	SM00332	Protein phosphatase 2C-related
ScanRegExp	IPR000222	272	280	PS01032	Protein phosphatase 2C

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ACACATGCTAGGCTTTCTCAG

Primer_r
: TAACGACCACACTAGAACTAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 17

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2634 bp
Genome contig ID	gi51511734f_54088231
PolyA signal sequence (TATAAA,-22)	+--------+--------+----*----+---- TCTATATAATATCTATAAACTGTTAATGCTGAGGT
Flanking genome sequence (327579 - 327628)	----+--------+--------+--------+--------+----* ATAGTCTGTGAATTATGTGTTTTGTATTTTTATTCATTGTGTAATTTAGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	17	f	54188231	54415808	7	99.0	Perfect prediction

Primer_f	: ACACATGCTAGGCTTTCTCAG
Primer_r	: TAACGACCACACTAGAACTAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1072

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information