| HUGE |
Gene/Protein Characteristic Table for KIAA1028 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK04502 |
|---|---|
| Accession No. : | AB028951 |
| Description : | Cell division cycle 2-like protein kinase 6. |
| HUGO Gene Name : | cell division cycle 2-like 6 (CDK8-like) (CDC2L6) |
| Clone Name : | fh00176s1 [Vector Info] |
| Flexi ORF Clone : | pF1KSDA1028
|
| Source : | Human fetal brain |
| Note : | We replaced fh00176, former representative clones for KIAA1028 with fh00176s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 6063 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 4557 bp Genome contig ID gi89161210r_110937874 PolyA signal sequence
(AATAAA,-21)
ATATTCTTGGTTGAAATAAAATTTAATTGACTTTGFlanking genome sequence
(100000 - 99951)
CTTCTGTGTGGATTTTTTAAATATAAAAAAAATCTTATAATAAGGCTTAG
Chr f/r start end exon identity class ContigView(URL based/DAS) 6 r 111037874 111243029 12 100.0 Internal No-hit
Features of the protein sequence |
Description | |
|---|---|---|
Length: 501 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| BlastProDom | IPR000719 | 27 | 239 | PD000001 | Protein kinase |
| HMMPfam | IPR000719 | 19 | 334 | PF00069 | Protein kinase |
| HMMSmart | IPR001245 | 20 | 332 | SM00219 | Tyrosine protein kinase |
| IPR002290 | 20 | 334 | SM00220 | Serine/threonine protein kinase | |
| ProfileScan | IPR000719 | 20 | 334 | PS50011 | Protein kinase |
| ScanRegExp | IPR000719 | 26 | 51 | PS00107 | Protein kinase |
| IPR008271 | 146 | 158 | PS00108 | Serine/threonine protein kinase |
| Method | No. | N terminal | transmembrane region | C terminal | type | length |
|---|---|---|---|---|---|---|
| - | - | - | - | - | - | - |
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|
Experimental conditions
| : ACTATGAGGCTGAAACAATCC | |
| : CAAAAGAGTAGTGCAGAAGGC | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 6 |
| : GeneBridge 4 | |
| : ACTATGAGGCTGAAACAATCC | |
| : CAAAAGAGTAGTGCAGAAGGC | |
| : 139 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
