| HUGE | 
| Gene/Protein Characteristic Table for KIAA1021 | 
| Link to : 
Rouge | 
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK04210 | 
|---|---|
| Accession No. : | AB028944 | 
| Description : | Probable phospholipid-transporting ATPase IH. | 
| HUGO Gene Name : | ATPase, class VI, type 11A (ATP11A) | 
| Clone Name : | af10412 [Vector Info] | 
| Source : | Human brain (amygdala) | 
| Note : | We replaced fg00592, former representative clones for KIAA1021 with af10412. (2005/08/06) | 
| Features of the cloned DNA sequence | Description | |
|---|---|---|
Length: 7611 bp
|   | 
| cloned DNA seq. | |
| Warning for N-terminal truncation: | YES | 
| Warning for coding interruption: | YES | 
Length of 3'UTR 4301 bp Genome contig ID gi51511729f_112387506 PolyA signal sequence 
(None)
GCCAGCCTTCCGCCACGAGCCAGCTGGGAAGGGCCFlanking genome sequence 
(200916 - 200965)
GCGGCCGCCTAAAGCCCCAGTCAACCCAGCCTGTGTCTGAGCAGACAGGG
Chr f/r start end exon identity class ContigView(URL based/DAS) 13 f 112487506 112588420 29 99.4 Perfect prediction 
| Features of the protein sequence | Description | |
|---|---|---|
Length: 1102 aa
|  | 
 | 
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|  | 
 | 
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 
    | Expression profile | Description | |
|---|---|---|
| RT-PCR-ELISA | Description | 
|---|

Experimental conditions
| : GCATTGGACACACACTACTGG | |
| : AACACGTAGTACATCCTCTGG | |
| : 95 °C | 
| RH mapping information | Description | |
|---|---|---|
| : 13 | 
| : UniGene | |
| : - | |
| : - | |
| : - | |
| : - | 
| How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage   | |