HUGE |
Gene/Protein Characteristic Table for KIAA1018 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Mapping | |
Product ID : | ORK01143 |
---|---|
Accession No. : | AB023235 |
Description : | myotubularin related protein 15. |
HUGO Gene Name : | |
Clone Name : | hj06112 [Vector Info] |
Flexi ORF Clone : | pF1KA1018
![]() |
Source : | Human adult brain |
Note : | We replaced hk10468, former representative clones for KIAA1018 with hj06112. (2004/1/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4835 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1543 bp Genome contig ID gi51511731f_28883421 PolyA signal sequence
(AATAAA,-19) +----*----+----*----+----*----+----
TCCTGCAAAATAAATAAATAAATATTTGCAAAACTFlanking genome sequence
(139181 - 139230) ----+----*----+----*----+----*----+----*----+----*
AAAGATTCTCTCATGAATGCCTTTTTTCAGATGAGCCACTCATCATTACA
Chr f/r start end exon identity class ContigView(URL based/DAS) 15 f 28983421 29022600 15 99.6 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1040 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
RH mapping information |
Description | |
---|---|---|
: 15 |
: GeneBridge 4 | |
: GTGTTTGGTTACGTGTGAGCC | |
: CTACATTGGAAAGAGCACACC | |
: 114 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |