HUGE

Gene/Protein Characteristic Table for KIAA1018

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK01143
Accession No. :	AB023235
Description :	myotubularin related protein 15.
HUGO Gene Name :
Clone Name :	hj06112 [Vector Info]
Flexi ORF Clone :	pF1KA1018
Source :	Human adult brain
Note :	We replaced hk10468, former representative clones for KIAA1018 with hj06112. (2004/1/10)

Features of the cloned DNA sequence	Description

Length: 4835 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1543 bp

Genome contig ID gi51511731f_28883421
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
TCCTGCAAAATAAATAAATAAATATTTGCAAAACT
Flanking genome sequence
(139181 - 139230)
----+----*----+----*----+----*----+----*----+----*
AAAGATTCTCTCATGAATGCCTTTTTTCAGATGAGCCACTCATCATTACA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 15 f 28983421 29022600 15 99.6 Perfect prediction

Features of the protein sequence	Description

Length: 1040 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG11275	100.0	myotubularin-re...	synthetic construct
XP_001109813	94.8	similar to C01G...	Macaca mulatta
XP_001491319	81.0	similar to Coil...	Equus caballus
Q69ZT1	71.2	Coiled-coil dom...	Mus musculus
XP_219706	70.7	similar to C01G...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR014883 916 1031 PF08774 VRR-NUC

HMMSmart IPR006642 64 88 SM00734 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR014883	916	1031	PF08774	VRR-NUC
HMMSmart	IPR006642	64	88	SM00734	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

: 15

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GTGTTTGGTTACGTGTGAGCC
Primer_r	: CTACATTGGAAAGAGCACACC
PCR product length	: 114 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1543 bp
Genome contig ID	gi51511731f_28883421
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TCCTGCAAAATAAATAAATAAATATTTGCAAAACT
Flanking genome sequence (139181 - 139230)	----+--------+--------+--------+--------+----* AAAGATTCTCTCATGAATGCCTTTTTTCAGATGAGCCACTCATCATTACA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	15	f	28983421	29022600	15	99.6	Perfect prediction

Gene/Protein Characteristic Table for KIAA1018

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information