HUGE

Gene/Protein Characteristic Table for KIAA0997

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00711
Accession No. :	AB023214
Description :	Zinc finger and BTB domain-containing protein 1.
HUGO Gene Name :	zinc finger and BTB domain containing 1 (ZBTB1)
Clone Name :	hk08613 [Vector Info]
Flexi ORF Clone :	pF1KSDA0997
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 3990 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1793 bp

Genome contig ID gi51511730f_63941174
PolyA signal sequence
(AATAAA,-31)
+----*----+----*----+----*----+----
ACCTAATAAAATTTCCTCCTCTATATTCCAAAGTT
Flanking genome sequence
(128989 - 129038)
----+----*----+----*----+----*----+----*----+----*
AAATTGTCTGTATATTACTTTTATTTATACTGTATTTTTTCCAATCTGGC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 14 f 64041174 64070161 3 99.1 Perfect prediction

Features of the protein sequence	Description

Length: 646 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAT06732	100.0	L2 [Homo sapiens].	Homo sapiens
EAW80863	99.8	zinc finger and...	Homo sapiens
XP_001499240	97.5	zinc finger and...	Equus caballus
Q9Y2K1	99.8	Zinc finger and...	Homo sapiens
AAH50719	99.7	ZBTB1 protein [...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002352	1e-05	20.4	KIAA0354
AB028943	0.00011	24.0	KIAA1020
AB007901	0.00012	21.4	KIAA0441

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR013069 16 122 PF00651 BTB/POZ

IPR007087 536 558 PF00096 Zinc finger

IPR007087 608 630 PF00096 Zinc finger

HMMSmart IPR000210 26 123 SM00225 BTB/POZ-like

IPR015880 218 244 SM00355 Zinc finger

IPR015880 423 445 SM00355 Zinc finger

IPR015880 536 556 SM00355 Zinc finger

IPR015880 580 602 SM00355 Zinc finger

IPR015880 608 630 SM00355 Zinc finger

ProfileScan IPR000210 26 93 PS50097 BTB/POZ-like

IPR007087 580 607 PS50157 Zinc finger

IPR007087 608 635 PS50157 Zinc finger

ScanRegExp IPR007087 582 602 PS00028 Zinc finger

IPR007087 610 630 PS00028 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013069	16	122	PF00651	BTB/POZ
IPR007087	536	558	PF00096	Zinc finger
IPR007087	608	630	PF00096	Zinc finger
HMMSmart	IPR000210	26	123	SM00225	BTB/POZ-like
IPR015880	218	244	SM00355	Zinc finger
IPR015880	423	445	SM00355	Zinc finger
IPR015880	536	556	SM00355	Zinc finger
IPR015880	580	602	SM00355	Zinc finger
IPR015880	608	630	SM00355	Zinc finger
ProfileScan	IPR000210	26	93	PS50097	BTB/POZ-like
IPR007087	580	607	PS50157	Zinc finger
IPR007087	608	635	PS50157	Zinc finger
ScanRegExp	IPR007087	582	602	PS00028	Zinc finger
IPR007087	610	630	PS00028	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GTCCTTCAGCAGCTAAACAAC

Primer_r
: TAGAACTGCCTTGTGTGCTTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 14

Experimental conditions

Panel name	: CCR
Primer_f	: GTCCTTCAGCAGCTAAACAAC
Primer_r	: TAGAACTGCCTTGTGTGCTTG
PCR product length	: 99 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1793 bp
Genome contig ID	gi51511730f_63941174
PolyA signal sequence (AATAAA,-31)	+--------+--------+----*----+---- ACCTAATAAAATTTCCTCCTCTATATTCCAAAGTT
Flanking genome sequence (128989 - 129038)	----+--------+--------+--------+--------+----* AAATTGTCTGTATATTACTTTTATTTATACTGTATTTTTTCCAATCTGGC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	14	f	64041174	64070161	3	99.1	Perfect prediction

Gene/Protein Characteristic Table for KIAA0997

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information