HUGE

Gene/Protein Characteristic Table for KIAA0988

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00708
Accession No. :	AB023205
Description :	Tubulin-specific chaperone D.
HUGO Gene Name :
Clone Name :	hk04388 [Vector Info]
Flexi ORF Clone :	pF1KSDA0988
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 3927 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 239 bp

Genome contig ID gi51511734f_78203250
PolyA signal sequence
(TATAAA,-19)
+----*----+----*----+----*----+----
ACACAAATGTGCTTCCTATAAAATCATGTACCAAG
Flanking genome sequence
(290619 - 290668)
----+----*----+----*----+----*----+----*----+----*
AAGTTCCTGCCTTTTGTCTCTGAGCCTGATGTGTGTAGGGGTGATGGAAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 17 f 78303250 78493867 39 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 1210 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG09930	100.0	tubulin-specifi...	synthetic construct
Q9BTW9	99.9	Tubulin-specifi...	Homo sapiens
NP_005984	99.8	beta-tubulin co...	Homo sapiens
XP_001169003	97.2	beta-tubulin co...	Pan troglodytes
CAA07022	96.0	beta-tubulin co...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000357 374 409 PF02985 HEAT

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000357	374	409	PF02985	HEAT

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TGTGTGACCTTCTGGGCGTAC

Primer_r
: TCAAGTGAAGGCAGAGGCGTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 17

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	239 bp
Genome contig ID	gi51511734f_78203250
PolyA signal sequence (TATAAA,-19)	+--------+--------+----*----+---- ACACAAATGTGCTTCCTATAAAATCATGTACCAAG
Flanking genome sequence (290619 - 290668)	----+--------+--------+--------+--------+----* AAGTTCCTGCCTTTTGTCTCTGAGCCTGATGTGTGTAGGGGTGATGGAAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	17	f	78303250	78493867	39	99.8	Perfect prediction

Primer_f	: TGTGTGACCTTCTGGGCGTAC
Primer_r	: TCAAGTGAAGGCAGAGGCGTC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0988

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information