HUGE

Gene/Protein Characteristic Table for KIAA0979

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01619
Accession No. :	AB023196
Description :	Androgen-induced proliferation inhibitor.
HUGO Gene Name :	PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae) (PDS5B)
Clone Name :	hj07056s1 [Vector Info]
Flexi ORF Clone :	pF1KSDA0979
Source :	Human adult brain
Note :	We replaced hj07056, former representative clones for KIAA0979 with hj07056s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 5309 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 857 bp

Genome contig ID gi51511729f_31958651
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
ATCTACTGTATCAATAAAATTCTGTAATTTGAATG
Flanking genome sequence
(289394 - 289443)
----+----*----+----*----+----*----+----*----+----*
AGTTTTTAATAGTCTAGAATGTTATTGTGTATAGATATTTCCTCTTGAAC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 13 f 32058642 32248043 35 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 1483 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001118201	99.3	similar to andr...	Macaca mulatta
XP_543139	98.7	similar to andr...	Canis lupus fam...
XP_509623	99.2	androgen-induce...	Pan troglodytes
Q9NTI5	100.0	Sister chromati...	Homo sapiens
Q6TRW4	96.3	Sister chromati...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB014548	2.4e-97	62.5	KIAA0648

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000357 419 455 PF02985 HEAT

IPR000637 1408 1420 PF02178 HMG-I and HMG-Y

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000357	419	455	PF02985	HEAT
IPR000637	1408	1420	PF02178	HMG-I and HMG-Y

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TGATGTCACTATTTGTTGGAG

Primer_r
: TTGCATGGTTGTCCTCCTATC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 13

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	857 bp
Genome contig ID	gi51511729f_31958651
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- ATCTACTGTATCAATAAAATTCTGTAATTTGAATG
Flanking genome sequence (289394 - 289443)	----+--------+--------+--------+--------+----* AGTTTTTAATAGTCTAGAATGTTATTGTGTATAGATATTTCCTCTTGAAC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	13	f	32058642	32248043	35	99.8	Perfect prediction

Primer_f	: TGATGTCACTATTTGTTGGAG
Primer_r	: TTGCATGGTTGTCCTCCTATC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0979

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information