HUGE |
Gene/Protein Characteristic Table for KIAA0969 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00703 |
---|---|
Accession No. : | AB023186 |
Description : | Pleckstrin homology domain-containing family A member 6. |
HUGO Gene Name : | pleckstrin homology domain containing, family A member 6 (PLEKHA6) |
Clone Name : | hj06525 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0969
![]() |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5047 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1583 bp Genome contig ID gi89161185r_202356972 PolyA signal sequence
(AGTAAA,-24) +----*----+----*----+----*----+----
GTTCATATGCAAGTAAAGATGACAATTTACTCAACFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAATATTTATCGAGCACCTTTTATGTACCAGGCACTGTTGTAGGTGCTTA
Chr f/r start end exon identity class ContigView(URL based/DAS) 1 r 202456972 202595667 24 99.6 Internal No-hit
Features of the protein sequence |
Description | |
---|---|---|
Length: 1091 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001849 | 103 | 201 | PF00169 | Pleckstrin-like |
HMMSmart | IPR001849 | 103 | 203 | SM00233 | Pleckstrin-like |
ProfileScan | IPR001849 | 102 | 201 | PS50003 | Pleckstrin-like |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: AGGCTAGGCGCTCTCATGATC | |
: GGCTACATTCGTCTCCAGGTG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 1 |
: UniGene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |