HUGE

Gene/Protein Characteristic Table for KIAA0938

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06102
Accession No. :	AB023155
Description :	Neuron navigator 3.
HUGO Gene Name :	neuron navigator 3 (NAV3)
Clone Name :	hh04777s1 [Vector Info]
Flexi ORF Clone :	pF1KA0938
Source :	Human adult brain
Note :	We replaced hh04777, former representative clones for KIAA0938 with hh04777s1. (2003/8/28)

Features of the cloned DNA sequence	Description

Length: 6268 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2493 bp

Genome contig ID gi89161190f_76935955
PolyA signal sequence
(ATTAAA,-24)
+----*----+----*----+----*----+----
ATTACTTTGCCATTAAAGTGGAATTATTTATTGAC
Flanking genome sequence
(194966 - 195015)
----+----*----+----*----+----*----+----*----+----*
AACATGGTGTGGTTTCTATTTATGGAAAAAAATGAATAATTTTGCATCAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 12 f 77035955 77130919 24 99.6 Perfect prediction

Features of the protein sequence	Description

Length: 1257 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAM73757	87.7	neuron navigato...	Homo sapiens
NP_055718	87.7	neuron navigato...	Homo sapiens
XP_509234	87.4	neuron navigato...	Pan troglodytes
BAG10403	88.0	neuron navigato...	synthetic construct
XP_001489298	85.1	neuron navigato...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037840	6.5e-131	55.4	KIAA1419
AB032977	7.5e-56	42.7	KIAA1151
AB033039	1.2e-12	36.8	KIAA1213

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMSmart IPR003593 920 1074 SM00382 AAA+ ATPase

Search method	interpro_ID	From	To	Entry	Definition
HMMSmart	IPR003593	920	1074	SM00382	AAA+ ATPase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TCAGTCATTGGAGAAGTTACC

Primer_r
: GACCTATTGACTTTGTGACAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 12

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2493 bp
Genome contig ID	gi89161190f_76935955
PolyA signal sequence (ATTAAA,-24)	+--------+--------+----*----+---- ATTACTTTGCCATTAAAGTGGAATTATTTATTGAC
Flanking genome sequence (194966 - 195015)	----+--------+--------+--------+--------+----* AACATGGTGTGGTTTCTATTTATGGAAAAAAATGAATAATTTTGCATCAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	12	f	77035955	77130919	24	99.6	Perfect prediction

Primer_f	: TCAGTCATTGGAGAAGTTACC
Primer_r	: GACCTATTGACTTTGTGACAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0938

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information