HUGE

Gene/Protein Characteristic Table for KIAA1151

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05639
Accession No. :	AB032977
Description :	Neuron navigator 1.
HUGO Gene Name :	neuron navigator 1 (NAV1)
Clone Name :	ff11693 [Vector Info]
Source :	Human fetal brain
Note :	We replaced hg02280 and bf00034, former representative clones for KIAA1151 with ff11693. (2002/5/10,2005/08/06)

Features of the cloned DNA sequence	Description

Length: 10693 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 5379 bp

Genome contig ID gi89161185f_199784740
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
ATTCCGAGCTGATTATGTAATAGGATGGAAAAAGT
Flanking genome sequence
(276340 - 276389)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAATCTAATTTGTATTTCCATGACAACGTGTTCTCC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 199884740 200061078 29 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 1770 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8NEY1	99.9	Neuron navigato...	Homo sapiens
CAD32470	99.8	steerin1 protei...	Homo sapiens
AAL05591	99.8	neuron navigato...	Homo sapiens
EAW91374	99.7	neuron navigato...	Homo sapiens
XP_848581	96.8	similar to neur...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB033039	5.3e-78	95.1	KIAA1213
AB037840	3.5e-56	42.5	KIAA1419
AB023155	4.2e-49	42.7	KIAA0938

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMSmart IPR003593 1443 1597 SM00382 AAA+ ATPase

ScanRegExp IPR008162 272 278 PS00387 Inorganic pyrophosphatase

Search method	interpro_ID	From	To	Entry	Definition
HMMSmart	IPR003593	1443	1597	SM00382	AAA+ ATPase
ScanRegExp	IPR008162	272	278	PS00387	Inorganic pyrophosphatase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TCCTTATTCCTTGGCACTGAC

Primer_r
: CCATGAGCCAGAACTTGTGAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	5379 bp
Genome contig ID	gi89161185f_199784740
PolyA signal sequence (None)	+--------+--------+----*----+---- ATTCCGAGCTGATTATGTAATAGGATGGAAAAAGT
Flanking genome sequence (276340 - 276389)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAATCTAATTTGTATTTCCATGACAACGTGTTCTCC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	199884740	200061078	29	99.4	Perfect prediction

Primer_f	: TCCTTATTCCTTGGCACTGAC
Primer_r	: CCATGAGCCAGAACTTGTGAG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1151

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information