HUGE

Gene/Protein Characteristic Table for KIAA0919

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00146
Accession No. :	AB023136
Description :	Exocyst complex component Sec15B.
HUGO Gene Name :	exocyst complex component 6B (EXOC6B)
Clone Name :	hh02580 [Vector Info]
Flexi ORF Clone :	pF1KA0919
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5782 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3648 bp

Genome contig ID gi89161199r_72442113
PolyA signal sequence
(ATTAAA,-31)
+----*----+----*----+----*----+----
ATTCATTAAAAATATATTCGTTATTTCTTAACTGG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAGAGATGTGATCTTATTTTAATTAATATATACACAAATTAAATATC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 r 72542113 72906662 18 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 710 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_515544	99.9	hypothetical pr...	Pan troglodytes
Q9Y2D4	100.0	Exocyst complex...	Homo sapiens
CAH90169	100.0	hypothetical pr...	Pongo abelii
XP_540235	99.4	similar to Exoc...	Canis lupus fam...
XP_001492141	99.2	exocyst complex...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR007225 502 710 PF04091 Exocyst complex subunit Sec15-like

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007225	502	710	PF04091	Exocyst complex subunit Sec15-like

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TGTCTACGTTCCTCAAATGCC

Primer_r
: CAGATAAATGCTCCCACTAGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TGTCTACGTTCCTCAAATGCC
Primer_r	: CAGATAAATGCTCCCACTAGG
PCR product length	: 188 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3648 bp
Genome contig ID	gi89161199r_72442113
PolyA signal sequence (ATTAAA,-31)	+--------+--------+----*----+---- ATTCATTAAAAATATATTCGTTATTTCTTAACTGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAGAGATGTGATCTTATTTTAATTAATATATACACAAATTAAATATC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	r	72542113	72906662	18	99.3	Perfect prediction

Gene/Protein Characteristic Table for KIAA0919

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information