HUGE

Gene/Protein Characteristic Table for KIAA0914

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK00145
Accession No. :	AB020721
Description :	Protein FAM13A1.
HUGO Gene Name :	family with sequence similarity 13, member A1 (FAM13A1)
Clone Name :	sj01106 [Vector Info]
Flexi ORF Clone :	pF1KA0914
Source :
Note :	We replaced hk04217, former representative clones for KIAA0914 with sj01106. (2004/1/10)

Features of the cloned DNA sequence	Description

Length: 4271 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2187 bp

Genome contig ID gi89161207r_89766520
PolyA signal sequence
(AATAAA,-17)
+----*----+----*----+----*----+----
ACCAAGTAAGTTATATAAAATAAATTGTGTATGAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATGTTGTGTTTTCCTTTGTAATTTCCACTAACTAACTAACTAACTTATAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 4 r 89866520 89963252 17 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 678 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAX06029	0	100.0	hCG39059, isofo...	Homo sapiens
XP_001162074	0	99.7	family with seq...	Pan troglodytes
O94988	6.3e-186	96.0	Protein FAM13A1.	Homo sapiens
XP_001161414	3.6e-185	94.6	family with seq...	Pan troglodytes
XP_001162111	3.8e-185	95.7	family with seq...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

: 4

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AGCTGAATGTTAAGGATGGGG
Primer_r	: TAACCAGGGCACTTCCAACAC
PCR product length	: 92 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2187 bp
Genome contig ID	gi89161207r_89766520
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- ACCAAGTAAGTTATATAAAATAAATTGTGTATGAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATGTTGTGTTTTCCTTTGTAATTTCCACTAACTAACTAACTAACTTATAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	4	r	89866520	89963252	17	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0914

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information