HUGE

Gene/Protein Characteristic Table for KIAA0907

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00679
Accession No. :	AB020714
Description :	BLOM7 beta.
HUGO Gene Name :
Clone Name :	hk10396 [Vector Info]
Flexi ORF Clone :	pF1KSDA0907
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4500 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2779 bp

Genome contig ID gi89161185r_154049460
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
CCATAATTTCATTATAAATAAATCTATAAATATTC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
TGCTTGTGGTTTCTCTGTTTTCTTCCACAACCCATCCATACACTGAAATT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 r 154149460 154170814 13 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 569 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001116302	2e-159	99.8	hypothetical pr...	Macaca mulatta
EDM00691	5.4e-151	96.9	similar to RIKE...	Rattus norvegicus
EDM00692	5.6e-151	96.9	similar to RIKE...	Rattus norvegicus
XP_864557	5.7e-151	95.7	hypothetical pr...	Canis lupus fam...
AAH92205	1e-150	96.5	LOC361980 prote...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TGCATCCCTGTTTTGTTTTGG

Primer_r
: GCTATGAGACCAATGTGCCTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2779 bp
Genome contig ID	gi89161185r_154049460
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- CCATAATTTCATTATAAATAAATCTATAAATATTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TGCTTGTGGTTTCTCTGTTTTCTTCCACAACCCATCCATACACTGAAATT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	r	154149460	154170814	13	99.3	Perfect prediction

Primer_f	: TGCATCCCTGTTTTGTTTTGG
Primer_r	: GCTATGAGACCAATGTGCCTG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0907

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information