ROUGE |
Gene/Protein Characteristic Table for mKIAA0907 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK173057 |
---|---|
mph01378 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3632 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2148 bp Genome contig ID gi65492966f_88329692 PolyA signal sequence
(AATAAA,-19) +----*----+----*----+----*----+----
CCATAATTTCATTATAAATAAATGTATAAATATTCFlanking genome sequence
(127029 - 127078) ----+----*----+----*----+----*----+----*----+----*
TGCTTGTCATTTCTCTTTTTCTTCCCTAGCCTGTTCATACACTAATATCA
KIAA Alignment based on: KIAA0907 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 9..1484
Length: 491 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage ![]() | |