HUGE

Gene/Protein Characteristic Table for KIAA0900

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00143
Accession No. :	AB020707
Description :	Wiskott-Aldrich syndrome protein family member 3.
HUGO Gene Name :	WAS protein family, member 3 (WASF3)
Clone Name :	hk09606s1 [Vector Info]
Flexi ORF Clone :	pF1KA0900
Source :	Human adult brain
Note :	We replaced hk09606, former representative clones for KIAA0900 with hk09606s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 4705 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3082 bp

Genome contig ID gi51511729f_25985097
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
AAGTAACATCTAAATAAAATTACACTTTTAACCCT
Flanking genome sequence
(175968 - 176017)
----+----*----+----*----+----*----+----*----+----*
AAGAGGTTTTGCTTATTAATAACAGTGTTGTATGTTTGGCTTTTTTGGAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 13 f 26085094 26161063 9 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 503 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9UPY6	1.4e-121	100.0	Wiskott-Aldrich...	Homo sapiens
XP_509596	2.2e-121	99.8	WAS protein fam...	Pan troglodytes
XP_001093804	3.4e-121	99.6	similar to WAS ...	Macaca mulatta
AAL51032	1.4e-120	99.6	WAVE3 [Homo sap...	Homo sapiens
XP_001491134	1.8e-117	96.4	WAS protein fam...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D87459	1.5e-19	50.0	KIAA0269

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003124 441 458 PF02205 Actin-binding WH2

HMMSmart IPR003124 441 458 SM00246 Actin-binding WH2

ProfileScan IPR003124 441 458 PS51082 Actin-binding WH2

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003124	441	458	PF02205	Actin-binding WH2
HMMSmart	IPR003124	441	458	SM00246	Actin-binding WH2
ProfileScan	IPR003124	441	458	PS51082	Actin-binding WH2

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AGAACACAGAAGCTACTATCC

Primer_r
: AGCTACAGGAAGACAACTAAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 13

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	3082 bp
Genome contig ID	gi51511729f_25985097
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- AAGTAACATCTAAATAAAATTACACTTTTAACCCT
Flanking genome sequence (175968 - 176017)	----+--------+--------+--------+--------+----* AAGAGGTTTTGCTTATTAATAACAGTGTTGTATGTTTGGCTTTTTTGGAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	13	f	26085094	26161063	9	99.2	Perfect prediction

Primer_f	: AGAACACAGAAGCTACTATCC
Primer_r	: AGCTACAGGAAGACAACTAAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0900

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information