ROUGE

Gene/Protein Characteristic Table for mKIAA0900

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	BC027038
Description :	WAS protein family, member 3.
Clone Name :	mbp13317 [Vector Info]
Source :	Mouse brain
Note :	A mutation resulted in loss of the NotI site in the vector (GCGGCCGC -> CGGCCGC) was found.

Features of the cloned DNA sequence	Description

Length: 1625 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 87 bp

Genome contig ID gi65498774f_145220477
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TTAGGAGCTCCTGTGCTCTCTGCACCCTCACAGTG
Flanking genome sequence
(134859 - 134908)
----+----*----+----*----+----*----+----*----+----*
GTATTTCCCTGTAGCTTTAGTCCCTTTTGTATTAACAGTGTGATTTGCTT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0900 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0900	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 24..1538
Length: 504 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q8VHI6	2e-122	100.0	Wiskott-Aldrich...	Mus musculus
BAE20647	2.1e-122	99.8	unnamed protein...	Mus musculus
EDL89588	2e-119	97.4	rCG42551 [Rattu...	Rattus norvegicus
EDL05804	3.3e-118	99.8	WAS protein fam...	Mus musculus
XP_001093804	2e-115	93.8	similar to WAS ...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003124 442 459 PF02205 Actin-binding WH2

HMMSmart IPR003124 442 459 SM00246 Actin-binding WH2

ProfileScan IPR000694 304 438 PS50099 Proline-rich region

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003124	442	459	PF02205	Actin-binding WH2
HMMSmart	IPR003124	442	459	SM00246	Actin-binding WH2
ProfileScan	IPR000694	304	438	PS50099	Proline-rich region

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	87 bp
Genome contig ID	gi65498774f_145220477
PolyA signal sequence (None)	+--------+--------+----*----+---- TTAGGAGCTCCTGTGCTCTCTGCACCCTCACAGTG
Flanking genome sequence (134859 - 134908)	----+--------+--------+--------+--------+----* GTATTTCCCTGTAGCTTTAGTCCCTTTTGTATTAACAGTGTGATTTGCTT

Gene/Protein Characteristic Table for mKIAA0900

Features of the cloned DNA sequence

Features of the protein sequence