HUGE

Gene/Protein Characteristic Table for KIAA0858

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00662
Accession No. :	AB020665
Description :	LIM domain only protein 7.
HUGO Gene Name :	LIM domain 7 (LMO7)
Clone Name :	hh02535 [Vector Info]
Flexi ORF Clone :	pF1KSDA0858
Source :	Human adult brain
Note :	We replaced hk06460, former representative clones for KIAA0858 with hh02535. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 5510 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 662 bp

Genome contig ID gi51511729f_75132868
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
CAATTGCATTTGTAAATAAACTTGCTGATGCATTT
Flanking genome sequence
(197946 - 197995)
----+----*----+----*----+----*----+----*----+----*
AACGAGTGGGTCGTCTTTTTCTTAGGTGTATGTGTCTGACCTCAGGCCTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 13 f 75232868 75330812 27 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 1557 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8WWI1	99.9	LIM domain only...	Homo sapiens
XP_001139990	99.5	LIM domain only...	Pan troglodytes
XP_001139733	99.5	LIM domain only...	Pan troglodytes
BAG09875	100.0	LIM domain only...	synthetic construct
NP_056667	99.9	LIM domain only...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB029025	7.8e-20	28.9	KIAA1102

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001478 942 984 PF00595 PDZ/DHR/GLGF

HMMSmart IPR001478 940 1012 SM00228 PDZ/DHR/GLGF

ProfileScan IPR001478 929 1005 PS50106 PDZ/DHR/GLGF

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001478	942	984	PF00595	PDZ/DHR/GLGF
HMMSmart	IPR001478	940	1012	SM00228	PDZ/DHR/GLGF
ProfileScan	IPR001478	929	1005	PS50106	PDZ/DHR/GLGF

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ATAGACATGAAATAGTTGCTC

Primer_r
: ATTCATTTATTCAACCACTGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 13

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	662 bp
Genome contig ID	gi51511729f_75132868
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- CAATTGCATTTGTAAATAAACTTGCTGATGCATTT
Flanking genome sequence (197946 - 197995)	----+--------+--------+--------+--------+----* AACGAGTGGGTCGTCTTTTTCTTAGGTGTATGTGTCTGACCTCAGGCCTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	13	f	75232868	75330812	27	99.8	Perfect prediction

Primer_f	: ATAGACATGAAATAGTTGCTC
Primer_r	: ATTCATTTATTCAACCACTGC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0858

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information