HUGE

Gene/Protein Characteristic Table for KIAA0839

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00651
Accession No. :	AB020646
Description :	Rab3 GTPase-activating protein non-catalytic subunit.
HUGO Gene Name :	RAB3 GTPase activating protein subunit 2 (non-catalytic) (RAB3GAP2)
Clone Name :	hk04507s1 [Vector Info]
Flexi ORF Clone :	pF1KSDA0839
Source :	Human adult brain
Note :	We replaced hk04507, former representative clones for KIAA0839 with hk04507s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 4961 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 779 bp

Genome contig ID gi89161185r_218290437
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CACTGTAAAAATGTATTATCTTGTAAAACTTATGT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAAGGCAAAGATACTAAAAATTTTAAGTCCGAC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 r 218390437 218512302 35 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1393 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAC35881	99.9	rab3-GAP regula...	Homo sapiens
XP_514211	99.9	rab3 GTPase-act...	Pan troglodytes
XP_001103011	98.9	similar to rab3...	Macaca mulatta
XP_536122	95.3	similar to rab3...	Canis lupus fam...
XP_001488184	94.6	RAB3 GTPase act...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AGCGTATAGAACACCCCACTC

Primer_r
: TCCTCAAGCACGGTCATCCTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	779 bp
Genome contig ID	gi89161185r_218290437
PolyA signal sequence (None)	+--------+--------+----*----+---- CACTGTAAAAATGTATTATCTTGTAAAACTTATGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAGGCAAAGATACTAAAAATTTTAAGTCCGAC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	r	218390437	218512302	35	100.0	Perfect prediction

Primer_f	: AGCGTATAGAACACCCCACTC
Primer_r	: TCCTCAAGCACGGTCATCCTC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0839

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information