HUGE

Gene/Protein Characteristic Table for KIAA0789

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00639
Accession No. :	AB018332
Description :	WSC domain containing 2.
HUGO Gene Name :	WSC domain containing 2 (WSCD2)
Clone Name :	pj01253 [Vector Info]
Flexi ORF Clone :	pF1KSDA0789
Source :	Human brain (hippocampus)
Note :	We replaced hk05559, former representative clones for KIAA0789 with pj01253. (2001/5/29)

Features of the cloned DNA sequence	Description

Length: 4217 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1775 bp

Genome contig ID gi89161190f_106947641
PolyA signal sequence
(ATTAAA,-28)
+----*----+----*----+----*----+----
CACCATCATTAAATGCGAGTTTTGTTGATGATTCT
Flanking genome sequence
(220386 - 220435)
----+----*----+----*----+----*----+----*----+----*
ACCATGTGGTAGAGTGTTGTGTAAGACAGGTTCACAAATGGGATGTTTTC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 12 f 107047641 107168025 9 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 620 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI10331	99.8	WSCD2 protein [...	Homo sapiens
BAG57182	99.6	unnamed protein...	Homo sapiens
XP_543448	95.6	similar to CG91...	Canis lupus fam...
EDL19945	91.6	RIKEN cDNA C530...	Mus musculus
EDM13973	91.3	rCG21835, isofo...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011095	5.6e-108	56.4	KIAA0523

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002889 185 264 PF01822 Carbohydrate-binding WSC

IPR002889 288 369 PF01822 Carbohydrate-binding WSC

HMMSmart IPR013994 182 274 SM00321 Carbohydrate-binding WSC

IPR013994 285 379 SM00321 Carbohydrate-binding WSC

ProfileScan IPR002889 182 274 PS51212 Carbohydrate-binding WSC

IPR002889 285 379 PS51212 Carbohydrate-binding WSC

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002889	185	264	PF01822	Carbohydrate-binding WSC
IPR002889	288	369	PF01822	Carbohydrate-binding WSC
HMMSmart	IPR013994	182	274	SM00321	Carbohydrate-binding WSC
IPR013994	285	379	SM00321	Carbohydrate-binding WSC
ProfileScan	IPR002889	182	274	PS51212	Carbohydrate-binding WSC
IPR002889	285	379	PS51212	Carbohydrate-binding WSC

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 72 VRFFTFLALYLTAGSLVFLHSGF 94 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	72	VRFFTFLALYLTAGSLVFLHSGF	94	PRIMARY	23

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GAAGTGCTGGTTAGTCTGTGC

Primer_r
: AAGCCATTCATGATCACAGGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 12

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GAAGTGCTGGTTAGTCTGTGC
Primer_r	: AAGCCATTCATGATCACAGGG
PCR product length	: 92 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1775 bp
Genome contig ID	gi89161190f_106947641
PolyA signal sequence (ATTAAA,-28)	+--------+--------+----*----+---- CACCATCATTAAATGCGAGTTTTGTTGATGATTCT
Flanking genome sequence (220386 - 220435)	----+--------+--------+--------+--------+----* ACCATGTGGTAGAGTGTTGTGTAAGACAGGTTCACAAATGGGATGTTTTC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	12	f	107047641	107168025	9	99.5	Perfect prediction

Gene/Protein Characteristic Table for KIAA0789

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information