HUGE

Gene/Protein Characteristic Table for KIAA0523

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07371
Accession No. :	AB011095
Description :	WSC domain containing 1.
HUGO Gene Name :	WSC domain containing 1 (WSCD1)
Clone Name :	hg01394 [Vector Info]
Flexi ORF Clone :	pF1KA0523
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5172 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3765 bp

Genome contig ID gi51511734f_5825024
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
TTGTTATATGAGCTAATAAATTCTGTTTATTGTTT
Flanking genome sequence
(143447 - 143496)
----+----*----+----*----+----*----+----*----+----*
AAGTTGGGTTGAGTTTAATTTCTGTTACTTATAACTCAGAACATGGTGCA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 17 f 5925024 5968469 8 99.1 Perfect prediction

Features of the protein sequence	Description

Length: 468 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAH09975	0	99.8	WSCD1 protein [...	Homo sapiens
XP_001101952	0	98.1	similar to CG91...	Macaca mulatta
XP_001918396	3.9e-206	90.6	WSC domain cont...	Equus caballus
XP_848808	7.5e-201	89.1	similar to CG91...	Canis lupus fam...
Q80XH4	2.8e-196	87.9	WSC domain-cont...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018332	1.3e-120	56.5	KIAA0789

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002889 38 117 PF01822 Carbohydrate-binding WSC

IPR002889 141 223 PF01822 Carbohydrate-binding WSC

HMMSmart IPR013994 35 127 SM00321 Carbohydrate-binding WSC

IPR013994 138 233 SM00321 Carbohydrate-binding WSC

ProfileScan IPR002889 35 127 PS51212 Carbohydrate-binding WSC

IPR002889 138 233 PS51212 Carbohydrate-binding WSC

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002889	38	117	PF01822	Carbohydrate-binding WSC
IPR002889	141	223	PF01822	Carbohydrate-binding WSC
HMMSmart	IPR013994	35	127	SM00321	Carbohydrate-binding WSC
IPR013994	138	233	SM00321	Carbohydrate-binding WSC
ProfileScan	IPR002889	35	127	PS51212	Carbohydrate-binding WSC
IPR002889	138	233	PS51212	Carbohydrate-binding WSC

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: CCCTTCAGTGGTGTCAGCTTC

Primer_r
: AAGACTTATGGGAATGCTGGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 17

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CCCTTCAGTGGTGTCAGCTTC
Primer_r	: AAGACTTATGGGAATGCTGGG
PCR product length	: 146 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3765 bp
Genome contig ID	gi51511734f_5825024
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TTGTTATATGAGCTAATAAATTCTGTTTATTGTTT
Flanking genome sequence (143447 - 143496)	----+--------+--------+--------+--------+----* AAGTTGGGTTGAGTTTAATTTCTGTTACTTATAACTCAGAACATGGTGCA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	17	f	5925024	5968469	8	99.1	Perfect prediction

Gene/Protein Characteristic Table for KIAA0523

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information