| HUGE |
Gene/Protein Characteristic Table for KIAA0778 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00634 |
|---|---|
| Accession No. : | AB018321 |
| Description : | Sodium/potassium-transporting ATPase subunit alpha-2 precursor. |
| HUGO Gene Name : | |
| Clone Name : | fh12074 [Vector Info] |
| Flexi ORF Clone : | pF1KSDA0778
![]() |
| Source : | Human fetal brain |
| Note : | We replaced hk05292, former representative clones for KIAA0778 with fh12074. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 5411 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 2259 bp Genome contig ID gi89161185f_158252187 PolyA signal sequence
(AATAAA,-22) +----*----+----*----+----*----+----
TGTACTTGAAAATAATAAAGTGGCATTTCTTTAAGFlanking genome sequence
(127811 - 127860) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAGAAATCTCTTCCATAATTCAGATTTCTACACTTTATACTTG
Chr f/r start end exon identity class ContigView(URL based/DAS) 1 f 158352187 158379996 23 99.5 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 1049 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|

Experimental conditions
| : TGGAGATTACTAACTGTGGAC | |
| : GATAATTAGCCCATGCACTCG | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 1 |
| : UniGene | |
| : - | |
| : - | |
| : - | |
| : - |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |