HUGE

Gene/Protein Characteristic Table for KIAA0765

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00126
Accession No. :	AB018308
Description :	RNA-binding protein 12.
HUGO Gene Name :	RNA binding motif protein 12 (RBM12)
Clone Name :	hk04803s1 [Vector Info]
Flexi ORF Clone :	pF1KA0765
Source :	Human adult brain
Note :	We replaced hk04803, former representative clones for KIAA0765 with hk04803s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 5332 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2382 bp

Genome contig ID gi51511747r_33601478
PolyA signal sequence
(ATTAAA,-27)
+----*----+----*----+----*----+----
GGACTGTAATTAAATGCTTTGCCCTCTGGAACTTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATTTTTGTGTATCTGAGATTTATTAACAGTGCTAACTGCTAAGGATACTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 20 r 33701478 33716224 2 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 952 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAH10603	99.9	hypothetical pr...	Homo sapiens
Q9NTZ6	100.0	RNA-binding pro...	Homo sapiens
CAC20441	99.9	RNA binding mot...	Homo sapiens
Q8SQ27	99.6	RNA-binding pro...	Macaca mulatta
ABY64675	99.5	RNA binding mot...	Papio anubis

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000504 452 522 PF00076 RNA recognition motif

IPR000504 566 636 PF00076 RNA recognition motif

IPR000504 878 949 PF00076 RNA recognition motif

HMMSmart IPR000504 325 395 SM00360 RNA recognition motif

IPR000504 451 523 SM00360 RNA recognition motif

IPR000504 565 637 SM00360 RNA recognition motif

IPR000504 877 950 SM00360 RNA recognition motif

ProfileScan IPR000504 324 399 PS50102 RNA recognition motif

IPR000504 450 527 PS50102 RNA recognition motif

IPR000504 876 952 PS50102 RNA recognition motif

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000504	452	522	PF00076	RNA recognition motif
IPR000504	566	636	PF00076	RNA recognition motif
IPR000504	878	949	PF00076	RNA recognition motif
HMMSmart	IPR000504	325	395	SM00360	RNA recognition motif
IPR000504	451	523	SM00360	RNA recognition motif
IPR000504	565	637	SM00360	RNA recognition motif
IPR000504	877	950	SM00360	RNA recognition motif
ProfileScan	IPR000504	324	399	PS50102	RNA recognition motif
IPR000504	450	527	PS50102	RNA recognition motif
IPR000504	876	952	PS50102	RNA recognition motif

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TTAGAGGATTGACAGTACAGG

Primer_r
: TTGAGGAGGCAGTATCTAGTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 20

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2382 bp
Genome contig ID	gi51511747r_33601478
PolyA signal sequence (ATTAAA,-27)	+--------+--------+----*----+---- GGACTGTAATTAAATGCTTTGCCCTCTGGAACTTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTTTTGTGTATCTGAGATTTATTAACAGTGCTAACTGCTAAGGATACTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	20	r	33701478	33716224	2	100.0	Perfect prediction

Primer_f	: TTAGAGGATTGACAGTACAGG
Primer_r	: TTGAGGAGGCAGTATCTAGTG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0765

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information