HUGE

Gene/Protein Characteristic Table for KIAA0752

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00621
Accession No. :	AB018295
Description :	NY-REN-7 antigen.
HUGO Gene Name :
Clone Name :	hk04439 [Vector Info]
Flexi ORF Clone :	pF1KSDA0752
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4332 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3326 bp

Genome contig ID gi51511721r_176970843
PolyA signal sequence
(ATTAAA,-15)
+----*----+----*----+----*----+----
TTTCATATTCCGTTTAAAAAATTAAAATTTTACAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAGACCAATGTCTTCTTTTCAATTCCAGTACAGTCTTCAGAAGTAACTAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 5 f 175423357 175486564 27 98.2 Perfect prediction

ContigView(URL based/DAS) 5 r 177070843 177140072 27 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 334 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
P0C7A2	3.5e-119	98.5	Protein FAM153B.	Homo sapiens
Q9UHL3	2.9e-114	100.0	Protein FAM153A...	Homo sapiens
BAF82207	1.3e-113	99.7	unnamed protein...	Homo sapiens
AAI66656	7e-113	99.0	Family with seq...	synthetic construct
XP_001134706	1.3e-103	95.0	hypothetical pr...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GCTTCTCCAGTCATTTCTTGC

Primer_r
: CCAAGTTATCAGGACAAGACC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 8

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GCTTCTCCAGTCATTTCTTGC
Primer_r	: CCAAGTTATCAGGACAAGACC
PCR product length	: 147 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3326 bp
Genome contig ID	gi51511721r_176970843
PolyA signal sequence (ATTAAA,-15)	+--------+--------+----*----+---- TTTCATATTCCGTTTAAAAAATTAAAATTTTACAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGACCAATGTCTTCTTTTCAATTCCAGTACAGTCTTCAGAAGTAACTAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	5	f	175423357	175486564	27	98.2	Perfect prediction
ContigView(URL based/DAS)	5	r	177070843	177140072	27	99.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0752

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information