HUGE |
Gene/Protein Characteristic Table for KIAA0742 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK01605 |
---|---|
Accession No. : | AB018285 |
Description : | JmjC domain-containing histone demethylation protein 2A. |
HUGO Gene Name : | jumonji domain containing 1A (JMJD1A) |
Clone Name : | hk04073s1 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0742
![]() |
Source : | Human adult brain |
Note : | We replaced hk04073, former representative clones for KIAA0742 with hk04073s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4652 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 596 bp Genome contig ID gi89161199f_86422019 PolyA signal sequence
(ATTAAA,-19) +----*----+----*----+----*----+----
GTGTTAAGCATTTTGCATTAAAATATTCATATAATFlanking genome sequence
(151332 - 151381) ----+----*----+----*----+----*----+----*----+----*
ATTTTGGCTCAGTTTATTGGCATTATCCTCTCATTGTGGTTTCAACACAA
Chr f/r start end exon identity class ContigView(URL based/DAS) 2 f 86522019 86573349 26 99.9 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1338 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: ACCTCGTATCAGCTCTGGAAC | |
: CTGTCACTTCCTCCATTGCTC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 2 |
: GeneBridge 4 | |
: ACCTCGTATCAGCTCTGGAAC | |
: CTGTCACTTCCTCCATTGCTC | |
: 172 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |