| HUGE |
Gene/Protein Characteristic Table for KIAA1380 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK05560 |
|---|---|
| Accession No. : | AB037801 |
| Description : | Probable JmjC domain-containing histone demethylation protein 2C. |
| HUGO Gene Name : | jumonji domain containing 1C (JMJD1C) |
| Clone Name : | fj05118 [Vector Info] |
| Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4614 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 815 bp Genome contig ID gi89161187r_64496996 PolyA signal sequence
(ATTAAA,-17) +----*----+----*----+----*----+----
AGGGGTTTTACATTTTCCATTAAAAGGACTTTATCFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAAAATTGACTTTTTCCAGAGTACTCCCTCTGTTGACAAGCATGACACTG
Chr f/r start end exon identity class ContigView(URL based/DAS) 10 r 64596996 64637613 17 99.6 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 1265 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|

Experimental conditions
| : TGAAATACCTGGTGCTCTGTG | |
| : ACTCCATATTCTTCAAGCAGC | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 10 |
| : unigene | |
| : - | |
| : - | |
| : - | |
| : - |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |