HUGE

Gene/Protein Characteristic Table for KIAA0731

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05806
Accession No. :	AB018274
Description :	La-related protein 1.
HUGO Gene Name :	La ribonucleoprotein domain family, member 1 (LARP1)
Clone Name :	hk03714 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4095 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Features of the protein sequence	Description

Length: 1096 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q6PKG0	92.8	La-related prot...	Homo sapiens
EAW61633	90.3	La ribonucleopr...	Homo sapiens
AAH01460	96.7	La ribonucleopr...	Homo sapiens
XP_001112050	95.4	similar to la r...	Macaca mulatta
XP_582017	89.3	similar to la r...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR006630 407 464 PF05383 RNA-binding protein Lupus La

HMMSmart IPR006630 401 477 SM00715 RNA-binding protein Lupus La

IPR006607 884 925 SM00684 Protein of unknown function DM15

IPR006607 926 964 SM00684 Protein of unknown function DM15

IPR006607 965 1000 SM00684 Protein of unknown function DM15

ProfileScan IPR006630 397 487 PS50961 RNA-binding protein Lupus La

ScanRegExp IPR001199 652 659 PS00191 Cytochrome b5

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006630	407	464	PF05383	RNA-binding protein Lupus La
HMMSmart	IPR006630	401	477	SM00715	RNA-binding protein Lupus La
IPR006607	884	925	SM00684	Protein of unknown function DM15
IPR006607	926	964	SM00684	Protein of unknown function DM15
IPR006607	965	1000	SM00684	Protein of unknown function DM15
ProfileScan	IPR006630	397	487	PS50961	RNA-binding protein Lupus La
ScanRegExp	IPR001199	652	659	PS00191	Cytochrome b5

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CCAACTATGCAGCCCACAAGA

Primer_r
: GTGATGACAAACCCCAGATGA

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 5

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CCAACTATGCAGCCCACAAGA
Primer_r	: GTGATGACAAACCCCAGATGA
PCR product length	: 129 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Gene/Protein Characteristic Table for KIAA0731

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information