HUGE

Gene/Protein Characteristic Table for KIAA0724

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00615
Accession No. :	AB018267
Description :	Importin-13.
HUGO Gene Name :	importin 13 (IPO13)
Clone Name :	hk02773 [Vector Info]
Flexi ORF Clone :	pF1KSDA0724
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 3893 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 339 bp

Genome contig ID gi89161185f_44085198
PolyA signal sequence
(ATTAAA,-21)
+----*----+----*----+----*----+----
ACCCCCCCATCCCCATTAAATTAATCCCAACATGC
Flanking genome sequence
(121084 - 121133)
----+----*----+----*----+----*----+----*----+----*
ATGTATGCATACATTTATTTAATCAACACCGCCGAATATTAGGCCCCTAG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 44185198 44206280 20 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 1047 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O94829	100.0	Importin-13; Sh...	Homo sapiens
AAH08194	99.9	Importin 13 [Ho...	Homo sapiens
BAF82862	99.7	unnamed protein...	Homo sapiens
Q8K0C1	99.2	Importin-13; Sh...	Mus musculus
XP_532612	99.2	similar to Impo...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001494 129 195 PF03810 Importin-beta

IPR013598 200 347 PF08389 Exportin-1/Importin-beta-like

ProfileScan IPR001494 129 195 PS50166 Importin-beta

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001494	129	195	PF03810	Importin-beta
IPR013598	200	347	PF08389	Exportin-1/Importin-beta-like
ProfileScan	IPR001494	129	195	PS50166	Importin-beta

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AGGATGGGAGGATGCTTGGAC

Primer_r
: GATGACACTACTGCAACCACC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AGGATGGGAGGATGCTTGGAC
Primer_r	: GATGACACTACTGCAACCACC
PCR product length	: 161 bp
PCR conditions	: 95 °C15 sec68 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	339 bp
Genome contig ID	gi89161185f_44085198
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- ACCCCCCCATCCCCATTAAATTAATCCCAACATGC
Flanking genome sequence (121084 - 121133)	----+--------+--------+--------+--------+----* ATGTATGCATACATTTATTTAATCAACACCGCCGAATATTAGGCCCCTAG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	44185198	44206280	20	99.8	Perfect prediction

Gene/Protein Characteristic Table for KIAA0724

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information