ROUGE |
Gene/Protein Characteristic Table for mKIAA0724 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129200 |
---|---|
importin 13. hypothetical protein MGC18698. |
|
mph01547 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3836 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 549 bp Genome contig ID gi65493515r_116753399 PolyA signal sequence
(AGTAAA,-17) +----*----+----*----+----*----+----
CCCTTCCTGTTCCCAAAGAGTAAACCTGGACTCTTFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
ACTGCTGCCTCTGCCTCCTTTCTCTGTCCTCCATCACCTACATGGACCCA
KIAA Alignment based on: KIAA0724 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 312..3275, 3538..3768
Length: 1064 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage ![]() | |