HUGE

Gene/Protein Characteristic Table for KIAA0717

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00611
Accession No. :	AB018260
Description :	Rho-related BTB domain-containing protein 2.
HUGO Gene Name :	Rho-related BTB domain containing 2 (RHOBTB2)
Clone Name :	fh19258 [Vector Info]
Flexi ORF Clone :	pF1KSDA0717
Source :	Human fetal brain
Note :	We replaced hj03868, former representative clones for KIAA0717 with fh19258. (2001/5/29)

Features of the cloned DNA sequence	Description

Length: 5449 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2728 bp

Genome contig ID gi51511724f_22813106
PolyA signal sequence
(CATAAA,-26)
+----*----+----*----+----*----+----
TCATGGATTCATAAATACATAAGTATTTTGTACAC
Flanking genome sequence
(120551 - 120600)
----+----*----+----*----+----*----+----*----+----*
AATGTGCTTCCTTGTTTGTATTATAACACATTTCAAATAGGGACCTTTGA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 8 f 22913037 22933655 10 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 751 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_519653	99.7	Rho-related BTB...	Pan troglodytes
Q9BYZ6	100.0	Rho-related BTB...	Homo sapiens
BAF85552	99.9	unnamed protein...	Homo sapiens
AAG61157	99.9	DBC2 [Homo sapi...	Homo sapiens
CAH91218	98.8	hypothetical pr...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018283	1.4e-69	68.0	KIAA0740
AB020685	7e-10	25.0	KIAA0878

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001806 39 60 PR00449 Ras GTPase

IPR001806 95 117 PR00449 Ras GTPase

IPR001806 155 168 PR00449 Ras GTPase

IPR001806 209 231 PR00449 Ras GTPase

HMMPfam IPR013753 124 233 PF00071 Ras

IPR013069 284 496 PF00651 BTB/POZ

IPR013069 514 622 PF00651 BTB/POZ

HMMSmart IPR003577 36 234 SM00173 Ras small GTPase

IPR003579 39 234 SM00175 Ras small GTPase

IPR003578 41 234 SM00174 Ras small GTPase

IPR000210 290 496 SM00225 BTB/POZ-like

IPR000210 524 622 SM00225 BTB/POZ-like

HMMTigr IPR005225 36 229 TIGR00231 Small GTP-binding protein domain

ProfileScan IPR000210 290 466 PS50097 BTB/POZ-like

IPR000210 524 591 PS50097 BTB/POZ-like

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001806	39	60	PR00449	Ras GTPase
IPR001806	95	117	PR00449	Ras GTPase
IPR001806	155	168	PR00449	Ras GTPase
IPR001806	209	231	PR00449	Ras GTPase
HMMPfam	IPR013753	124	233	PF00071	Ras
IPR013069	284	496	PF00651	BTB/POZ
IPR013069	514	622	PF00651	BTB/POZ
HMMSmart	IPR003577	36	234	SM00173	Ras small GTPase
IPR003579	39	234	SM00175	Ras small GTPase
IPR003578	41	234	SM00174	Ras small GTPase
IPR000210	290	496	SM00225	BTB/POZ-like
IPR000210	524	622	SM00225	BTB/POZ-like
HMMTigr	IPR005225	36	229	TIGR00231	Small GTP-binding protein domain
ProfileScan	IPR000210	290	466	PS50097	BTB/POZ-like
IPR000210	524	591	PS50097	BTB/POZ-like

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AGTCGGATTCAGGAAACACCC

Primer_r
: TGAGTGACAGGAAACCAGGGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 8

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AGTCGGATTCAGGAAACACCC
Primer_r	: TGAGTGACAGGAAACCAGGGC
PCR product length	: 104 bp
PCR conditions	: 95 °C15 sec66 °C60 sec32 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2728 bp
Genome contig ID	gi51511724f_22813106
PolyA signal sequence (CATAAA,-26)	+--------+--------+----*----+---- TCATGGATTCATAAATACATAAGTATTTTGTACAC
Flanking genome sequence (120551 - 120600)	----+--------+--------+--------+--------+----* AATGTGCTTCCTTGTTTGTATTATAACACATTTCAAATAGGGACCTTTGA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	8	f	22913037	22933655	10	99.3	Perfect prediction

Gene/Protein Characteristic Table for KIAA0717

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information