| HUGE |
Gene/Protein Characteristic Table for KIAA0705 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK05908 |
|---|---|
| Accession No. : | AB014605 |
| Description : | Membrane-associated guanylate kinase, WW and PDZ domain-containing protein 2. |
| HUGO Gene Name : | membrane associated guanylate kinase, WW and PDZ domain containing 2 (MAGI2) |
| Clone Name : | hg03359s1 [Vector Info] |
| Source : | Human adult brain |
| Note : | We replaced hg03359, former representative clones for KIAA0705 with hg03359s1. (2003/4/2) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 6795 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2234 bp Genome contig ID gi89161213r_77384334 PolyA signal sequence
(AATAAA,-16) +----*----+----*----+----*----+----
ATATTCTAAAACACTGTCAAATAAAATATATATCCFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAAAATCTTTTCTTTTTCCAACTATATAGGCTGTGTGTTAATTTGAAATA
Chr f/r start end exon identity class ContigView(URL based/DAS) 7 r 77484334 78920807 20 99.5 Internal No-hit
Features of the protein sequence |
Description | |
|---|---|---|
Length: 1483 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
| RT-PCR | Description |
|---|
| : CAGCGGCCAGTTTTGTGTTGC | |
| : GTACTGATCCAACCCATTCGC | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 7 |
| : GeneBridge 4 | |
| : CAGCGGCCAGTTTTGTGTTGC | |
| : GTACTGATCCAACCCATTCGC | |
| : 135 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |