HUGE

Gene/Protein Characteristic Table for KIAA1634

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :
Accession No. :	AB046854
Description :	membrane-associated guanylate kinase-related 3.
HUGO Gene Name :
Clone Name :	fh21781 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5641 bp
Physical map
Restriction map
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
Comparison between the cloned and the revised DNA sequences.
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq. revised DNA seq.
Warning for N-terminal truncation:
YES YES

Warning for coding interruption:
YES YES

Integrity of 3' end

Length of 3'UTR 3015 bp

Genome contig ID gi89161185f_113834625
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
AGTACCTTTATATATACACTTGAGGTTCTGATTAG
Flanking genome sequence
(195392 - 195441)
----+----*----+----*----+----*----+----*----+----*
AGAAAGATCTGTAAATTGCTCATTATTTTTTATATAGATATTTAAAAAAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 113934617 114030015 18 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 874 aa
This protein sequence is predicted from the revised DNA sequence

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAH74143	100.0	membrane associ...	Homo sapiens
AAG43837	99.5	membrane-associ...	Homo sapiens
CAH74141	100.0	membrane associ...	Homo sapiens
XP_001097865	98.7	similar to memb...	Macaca mulatta
XP_001495586	96.0	membrane associ...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB014605	1.5e-43	50.4	KIAA0705
D63481	5e-08	26.6	KIAA0147
AB007899	1.3e-05	45.8	KIAA0439
AB058752	1.6e-05	33.7	KIAA1849
D42055	1.7e-05	32.2	KIAA0093

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001202 44 73 PF00397 WW/Rsp5/WWP

IPR001202 90 119 PF00397 WW/Rsp5/WWP

IPR001478 159 225 PF00595 PDZ/DHR/GLGF

IPR001478 475 556 PF00595 PDZ/DHR/GLGF

IPR001478 600 684 PF00595 PDZ/DHR/GLGF

IPR001478 770 849 PF00595 PDZ/DHR/GLGF

HMMSmart IPR001202 43 75 SM00456 WW/Rsp5/WWP

IPR001202 89 121 SM00456 WW/Rsp5/WWP

IPR001478 167 243 SM00228 PDZ/DHR/GLGF

IPR001478 335 405 SM00228 PDZ/DHR/GLGF

IPR001478 483 559 SM00228 PDZ/DHR/GLGF

IPR001478 609 687 SM00228 PDZ/DHR/GLGF

IPR001478 778 852 SM00228 PDZ/DHR/GLGF

ProfileScan IPR001202 42 75 PS50020 WW/Rsp5/WWP

IPR001202 88 121 PS50020 WW/Rsp5/WWP

IPR001478 159 227 PS50106 PDZ/DHR/GLGF

IPR001478 327 390 PS50106 PDZ/DHR/GLGF

IPR001478 475 557 PS50106 PDZ/DHR/GLGF

IPR001478 600 687 PS50106 PDZ/DHR/GLGF

IPR001478 770 852 PS50106 PDZ/DHR/GLGF

ScanRegExp IPR001202 48 73 PS01159 WW/Rsp5/WWP

IPR001202 94 119 PS01159 WW/Rsp5/WWP

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001202	44	73	PF00397	WW/Rsp5/WWP
IPR001202	90	119	PF00397	WW/Rsp5/WWP
IPR001478	159	225	PF00595	PDZ/DHR/GLGF
IPR001478	475	556	PF00595	PDZ/DHR/GLGF
IPR001478	600	684	PF00595	PDZ/DHR/GLGF
IPR001478	770	849	PF00595	PDZ/DHR/GLGF
HMMSmart	IPR001202	43	75	SM00456	WW/Rsp5/WWP
IPR001202	89	121	SM00456	WW/Rsp5/WWP
IPR001478	167	243	SM00228	PDZ/DHR/GLGF
IPR001478	335	405	SM00228	PDZ/DHR/GLGF
IPR001478	483	559	SM00228	PDZ/DHR/GLGF
IPR001478	609	687	SM00228	PDZ/DHR/GLGF
IPR001478	778	852	SM00228	PDZ/DHR/GLGF
ProfileScan	IPR001202	42	75	PS50020	WW/Rsp5/WWP
IPR001202	88	121	PS50020	WW/Rsp5/WWP
IPR001478	159	227	PS50106	PDZ/DHR/GLGF
IPR001478	327	390	PS50106	PDZ/DHR/GLGF
IPR001478	475	557	PS50106	PDZ/DHR/GLGF
IPR001478	600	687	PS50106	PDZ/DHR/GLGF
IPR001478	770	852	PS50106	PDZ/DHR/GLGF
ScanRegExp	IPR001202	48	73	PS01159	WW/Rsp5/WWP
IPR001202	94	119	PS01159	WW/Rsp5/WWP

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CCAGAACTATATTTACCCACC

Primer_r
: TTAGGAAGAACCACATAGGAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.	revised DNA seq.
Warning for N-terminal truncation:	YES	YES
Warning for coding interruption:	YES	YES

Length of 3'UTR	3015 bp
Genome contig ID	gi89161185f_113834625
PolyA signal sequence (None)	+--------+--------+----*----+---- AGTACCTTTATATATACACTTGAGGTTCTGATTAG
Flanking genome sequence (195392 - 195441)	----+--------+--------+--------+--------+----* AGAAAGATCTGTAAATTGCTCATTATTTTTTATATAGATATTTAAAAAAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	113934617	114030015	18	99.9	Perfect prediction

Primer_f	: CCAGAACTATATTTACCCACC
Primer_r	: TTAGGAAGAACCACATAGGAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1634

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information