HUGE

Gene/Protein Characteristic Table for KIAA0699

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :
Accession No. :	AB014599
Description :	Protein bicaudal D homolog 2.
HUGO Gene Name :	bicaudal D homolog 2 (Drosophila) (BICD2)
Clone Name :	hg00621 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6327 bp
Physical map
Restriction map
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
Comparison between the cloned and the revised DNA sequences.
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq. revised DNA seq.
Warning for N-terminal truncation:
YES YES

Warning for coding interruption:
YES NO

Integrity of 3' end

Length of 3'UTR 3784 bp

Genome contig ID gi89161216r_94413474
PolyA signal sequence
(AATAAA,-11)
+----*----+----*----+----*----+----
ACATTGGTAGGACCAATAAAGAATAATAAAAAGAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAGCACATGTTTGTTCTCTGTGGTTGTTCTGACTCCGTGCTCCAGATAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 9 r 94513474 94566824 7 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 847 aa
This protein sequence is predicted from the revised DNA sequence

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH73970	100.0	Bicaudal D homo...	Homo sapiens
XP_001147166	99.9	bicaudal D homo...	Pan troglodytes
XP_001103763	98.7	similar to bica...	Macaca mulatta
Q8TD16	99.9	Protein bicauda...	Homo sapiens
XP_520695	99.8	bicaudal D homo...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description
: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ACTGGCTTTGTAGGCATTCAC

Primer_r
: CTTAGTGTCAGAATGTTGGTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 9

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: ACTGGCTTTGTAGGCATTCAC
Primer_r	: CTTAGTGTCAGAATGTTGGTC
PCR product length	: 208 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.	revised DNA seq.
Warning for N-terminal truncation:	YES	YES
Warning for coding interruption:	YES	NO

Length of 3'UTR	3784 bp
Genome contig ID	gi89161216r_94413474
PolyA signal sequence (AATAAA,-11)	+--------+--------+----*----+---- ACATTGGTAGGACCAATAAAGAATAATAAAAAGAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAGCACATGTTTGTTCTCTGTGGTTGTTCTGACTCCGTGCTCCAGATAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	9	r	94513474	94566824	7	99.4	Perfect prediction

Gene/Protein Characteristic Table for KIAA0699

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information