ROUGE

Gene/Protein Characteristic Table for mKIAA0699

Link to : HUGE \| InGAP \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122348
Description :	Cytoskeleton-like bicaudal D protein homolog 2.
Clone Name :	mbg04602 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 6318 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3667 bp

Genome contig ID gi65535943f_48841099
PolyA signal sequence
(AATAAA,-13)
+----*----+----*----+----*----+----
ATTGGTAGGACCAATAAAGAATAATAAAACAATTG
Flanking genome sequence
(145436 - 145485)
----+----*----+----*----+----*----+----*----+----*
AAGCACATGCGTGCCCTCTGTGATTGCTTCACTCCTGCACCAGGTGACCG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0699 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0699	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 42..2651
Length: 869 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_001034268	100.0	bicaudal D homo...	Mus musculus
AAI00661	97.9	Bicaudal D homo...	Rattus norvegicus
Q921C5	99.9	Protein bicauda...	Mus musculus
AAH73970	94.7	Bicaudal D homo...	Homo sapiens
XP_001147166	94.6	bicaudal D homo...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK220497	2.4e-37	64.0	mKIAA4125

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ProfileScan NULL 24 270 PS50313 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	NULL	24	270	PS50313	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	3667 bp
Genome contig ID	gi65535943f_48841099
PolyA signal sequence (AATAAA,-13)	+--------+--------+----*----+---- ATTGGTAGGACCAATAAAGAATAATAAAACAATTG
Flanking genome sequence (145436 - 145485)	----+--------+--------+--------+--------+----* AAGCACATGCGTGCCCTCTGTGATTGCTTCACTCCTGCACCAGGTGACCG

Gene/Protein Characteristic Table for mKIAA0699

Features of the cloned DNA sequence

Features of the protein sequence