HUGE

Gene/Protein Characteristic Table for KIAA0693

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00607
Accession No. :	AB014593
Description :	SS18-like protein 1.
HUGO Gene Name :	synovial sarcoma translocation gene on chromosome 18-like 1 (SS18L1)
Clone Name :	hk03927 [Vector Info]
Flexi ORF Clone :	pF1KSDA0693
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4493 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3276 bp

Genome contig ID gi51511747f_60052246
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
GTGTAATCTCTTAATAAACTGGTTCTTCAAAAATC
Flanking genome sequence
(138691 - 138740)
----+----*----+----*----+----*----+----*----+----*
ATCCTATAAAGTGAGTTTTCATGAAGTTAACGGGATTTTGGTGTGATGTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 20 f 60152246 60190935 11 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 404 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
O75177	2.2e-128	100.0	SS18-like prote...	Homo sapiens
BAF84174	3.2e-128	99.7	unnamed protein...	Homo sapiens
ABM81834	4e-128	99.7	synovial sarcom...	synthetic construct
BAG61729	1.6e-125	99.2	unnamed protein...	Homo sapiens
EAW75391	4.1e-121	100.0	synovial sarcom...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom NULL 9 76 PD020165 NULL

HMMPfam IPR007726 19 84 PF05030 SSXT

ScanRegExp IPR000532 108 130 PS00260 Glucagon/GIP/secretin/VIP

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	NULL	9	76	PD020165	NULL
HMMPfam	IPR007726	19	84	PF05030	SSXT
ScanRegExp	IPR000532	108	130	PS00260	Glucagon/GIP/secretin/VIP

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description
: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TGAAGTGTGGTTGATGGTGCT

Primer_r
: ATAGGAAGAAGAATGAGCGTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 20

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TGAAGTGTGGTTGATGGTGCT
Primer_r	: ATAGGAAGAAGAATGAGCGTC
PCR product length	: 104 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3276 bp
Genome contig ID	gi51511747f_60052246
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- GTGTAATCTCTTAATAAACTGGTTCTTCAAAAATC
Flanking genome sequence (138691 - 138740)	----+--------+--------+--------+--------+----* ATCCTATAAAGTGAGTTTTCATGAAGTTAACGGGATTTTGGTGTGATGTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	20	f	60152246	60190935	11	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0693

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information