HUGE |
Gene/Protein Characteristic Table for KIAA0693 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00607 |
---|---|
Accession No. : | AB014593 |
Description : | SS18-like protein 1. |
HUGO Gene Name : | synovial sarcoma translocation gene on chromosome 18-like 1 (SS18L1) |
Clone Name : | hk03927 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0693
![]() |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4493 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 3276 bp Genome contig ID gi51511747f_60052246 PolyA signal sequence
(AATAAA,-23) +----*----+----*----+----*----+----
GTGTAATCTCTTAATAAACTGGTTCTTCAAAAATCFlanking genome sequence
(138691 - 138740) ----+----*----+----*----+----*----+----*----+----*
ATCCTATAAAGTGAGTTTTCATGAAGTTAACGGGATTTTGGTGTGATGTG
Chr f/r start end exon identity class ContigView(URL based/DAS) 20 f 60152246 60190935 11 100.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 404 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: TGAAGTGTGGTTGATGGTGCT | |
: ATAGGAAGAAGAATGAGCGTC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 20 |
: GeneBridge 4 | |
: TGAAGTGTGGTTGATGGTGCT | |
: ATAGGAAGAAGAATGAGCGTC | |
: 104 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |