| HUGE |
Gene/Protein Characteristic Table for KIAA0682 |
|
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00114 |
|---|---|
| Accession No. : | AB014582 |
| Description : | Probable RNA-binding protein 19. |
| HUGO Gene Name : | RNA binding motif protein 19 (RBM19) |
| Clone Name : | hk02879 [Vector Info] |
| Flexi ORF Clone : | pF1KA0682
|
| Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4422 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1460 bp Genome contig ID gi89161190r_112638930 PolyA signal sequence
(AATAAA,-16)
TTTTTTCAGCCGTCTTAATAATAAAAGATTAATAGFlanking genome sequence
(100000 - 99951)
AATGCTTGCATAATAATAATTTATTCACCCATGCCGCCTAGGCCATTGAA
Chr f/r start end exon identity class ContigView(URL based/DAS) 12 r 112738930 112888494 25 99.4 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 973 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
|---|---|---|
| RT-PCR | Description |
|---|
| RT-PCR-ELISA | Description |
|---|
Experimental conditions
| : TGCCAGTCAAACGTTCAAAGG | |
| : AAGAGAAGTGGGTGGAAAAGC | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 12 |
| : GeneBridge 4 | |
| : TGCCAGTCAAACGTTCAAAGG | |
| : AAGAGAAGTGGGTGGAAAAGC | |
| : 167 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
